Morpholino
MO1-ptgs2a
- ID
- ZDB-MRPHLNO-050722-5
- Name
- MO1-ptgs2a
- Previous Names
-
- MO1-ptgs2
- zCOX-2-A (1)
- Target
- Sequence
-
5' - AACCAGTTTATTCATTCCAGAAGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed against translation start
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptgs2a
No data available
Phenotype
Phenotype resulting from MO1-ptgs2a
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-ptgs2a
1 - 5 of 36 Show all
Citations
- Marra, A.N., Adeeb, B.D., Chambers, B.E., Drummond, B.E., Ulrich, M., Addiego, A., Springer, M., Poureetezadi, S.J., Chambers, J.M., Ronshaugen, M., Wingert, R.A. (2019) Prostaglandin signaling regulates renal multiciliated cell specification and maturation. Proceedings of the National Academy of Sciences of the United States of America. 116(17):8409-8418
- Poureetezadi, S.J., Cheng, C.N., Chambers, J.M., Drummond, B.E., Wingert, R.A. (2016) Prostaglandin signaling regulates nephron segment patterning of renal progenitors during zebrafish kidney development. eLIFE. 5
- Esain, V., Kwan, W., Carroll, K.J., Cortes, M., Liu, S.Y., Frechette, G.M., Sheward, L.M., Nissim, S., Goessling, W., North, T.E. (2015) Cannabinoid Receptor-2 Regulates Embryonic Hematopoietic Stem Cell Development via PGE2 and P-selectin Activity. Stem cells (Dayton, Ohio). 33(8):2596-612
- Nissim, S., Sherwood, R.I., Wucherpfennig, J., Saunders, D., Harris, J.M., Esain, V., Carroll, K.J., Frechette, G.M., Kim, A.J., Hwang, K.L., Cutting, C.C., Elledge, S., North, T.E., and Goessling, W. (2014) Prostaglandin E2 regulates liver versus pancreas cell-fate decisions and endodermal outgrowth. Developmental Cell. 28(4):423-437
- Eisinger, A.L., Nadauld, L.D., Shelton, D.N., Prescott, S.M., Stafforini, D.M., and Jones, D.A. (2007) Retinoic Acid Inhibits β-Catenin through Suppression of Cox-2: A role for truncated adenomatous polyposis coli. The Journal of biological chemistry. 282(40):29394-29400
- North, T.E., Goessling, W., Walkley, C.R., Lengerke, C., Kopani, K.R., Lord, A.M., Weber, G.J., Bowman, T.V., Jang, I.H., Grosser, T., Fitzgerald, G.A., Daley, G.Q., Orkin, S.H., and Zon, L.I. (2007) Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature. 447(7147):1007-1011
- Grosser, T., Yusuff, S., Cheskis, E., Pack, M.A., and FitzGerald, G.A. (2002) Developmental expression of functional cyclooxygenases in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 99(12):8418-8423
1 - 7 of 7
Show