Morpholino

MO1-lzic

ID
ZDB-MRPHLNO-050722-1
Name
MO1-lzic
Previous Names
None
Target
Sequence
5' - AGATGTGTTTACCTGCACTCCTCTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lzic
Expressed Gene Anatomy Figures
ctslb Fig. 6 with image from Clements et al., 2005
egr2b Fig. 6 with image from Clements et al., 2005
en2a Fig. 6 with image from Clements et al., 2005
myod1 Fig. 6 with image from Clements et al., 2005
neurog1 Fig. 6 with image from Clements et al., 2005
pax6a Fig. 6 with image from Clements et al., 2005
shha Fig. 6 with image from Clements et al., 2005
snai1b Fig. 6 with image from Clements et al., 2005
zic1 Fig. 6 with image from Clements et al., 2005
Phenotype
Phenotype resulting from MO1-lzic
Phenotype Fish Figures
brain degenerate, abnormal WIK/AB + MO1-lzic Fig. 6 with image from Clements et al., 2005
cell death increased occurrence, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
diencephalon degenerate, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
eye degenerate, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
head decreased size, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
hindbrain degenerate, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
neural crest degenerate, abnormal WIK/AB + MO1-lzic Fig. 6 with image from Clements et al., 2005
neural tube dorsal region degenerate, abnormal WIK/AB + MO1-lzic Fig. 5 with image,  Fig. 6 with image from Clements et al., 2005
optic tectum degenerate, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
telencephalon degenerate, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
whole organism decreased length, abnormal WIK/AB + MO1-lzic Fig. 5 with image from Clements et al., 2005
Phenotype of all Fish created by or utilizing MO1-lzic
Phenotype Fish Conditions Figures
brain degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 6 with image from Clements et al., 2005
diencephalon degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
optic tectum degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
head decreased size, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
neural tube dorsal region degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image,  Fig. 6 with image from Clements et al., 2005
cell death increased occurrence, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
hindbrain degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
whole organism decreased length, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
neural crest degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 6 with image from Clements et al., 2005
eye degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
telencephalon degenerate, abnormal WIK/AB + MO1-lzic standard conditions Fig. 5 with image from Clements et al., 2005
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.