Morpholino

MO1-scrib

ID
ZDB-MRPHLNO-050718-1
Name
MO1-scrib
Previous Names
  • MO/ATG (1)
Target
Sequence
5' - CCACAGCGGGATACACTTCAGCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-scrib
Expressed Gene Anatomy Figures
birc5a Fig. S5 with image from Skouloudaki et al., 2009
myod1 Fig. 8 with image from Wada et al., 2005
Phenotype
Phenotype resulting from MO1-scrib
Phenotype Fish Figures
anatomical structure birc5a expression increased distribution, abnormal WT + MO1-scrib Fig. S5 with image from Skouloudaki et al., 2009
axis decreased length, abnormal WT + MO1-scrib Fig. 8 with image from Wada et al., 2005
convergent extension disrupted, abnormal AB + MO1-scrib Fig. 6 with image from Vervenne et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-scrib Fig. 8 with image from Wada et al., 2005
cranial vasculature malformed, abnormal s843Tg + MO1-scrib Fig. 5 from Michaelis et al., 2013
establishment of mitotic spindle orientation decreased process quality, abnormal WT + MO1-scrib Fig. 1 with image from Zigman et al., 2011
head hemorrhagic, abnormal s843Tg + MO1-scrib Fig. 5 from Michaelis et al., 2013
intersegmental vessel decreased length, abnormal s843Tg + MO1-scrib Fig. 5 from Michaelis et al., 2013
intersegmental vessel vasculature development delayed, abnormal s843Tg + MO1-scrib Fig. 5 from Michaelis et al., 2013
neural keel neuroepithelial cell disorganized, abnormal WT + MO1-scrib Fig. 1 with image from Zigman et al., 2011
neural tube neuroepithelial cell disorganized, abnormal WT + MO1-scrib Fig. 1 with image from Zigman et al., 2011
neuroepithelial cell mitotic spindle direction, abnormal WT + MO1-scrib Fig. 1 with image from Zigman et al., 2011
pronephros cystic, abnormal WT + MO1-scrib Fig. 1 with image from Skouloudaki et al., 2009
secondary neural tube formation decreased process quality, abnormal WT + MO1-scrib Fig. 1 with image from Zigman et al., 2011
somite increased width, abnormal WT + MO1-scrib Fig. 8 with image from Wada et al., 2005
Phenotype of all Fish created by or utilizing MO1-scrib
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO1-scrib standard conditions Fig. 6 with image from Vervenne et al., 2008
axis decreased length, abnormal WT + MO1-scrib standard conditions Fig. 8 with image from Wada et al., 2005
neural keel neuroepithelial cell disorganized, abnormal WT + MO1-scrib standard conditions Fig. 1 with image from Zigman et al., 2011
establishment of mitotic spindle orientation decreased process quality, abnormal WT + MO1-scrib standard conditions Fig. 1 with image from Zigman et al., 2011
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-scrib standard conditions Fig. 8 with image from Wada et al., 2005
neuroepithelial cell mitotic spindle direction, abnormal WT + MO1-scrib standard conditions Fig. 1 with image from Zigman et al., 2011
somite increased width, abnormal WT + MO1-scrib standard conditions Fig. 8 with image from Wada et al., 2005
pronephros cystic, abnormal WT + MO1-scrib standard conditions Fig. 1 with image from Skouloudaki et al., 2009
secondary neural tube formation decreased process quality, abnormal WT + MO1-scrib standard conditions Fig. 1 with image from Zigman et al., 2011
neural tube neuroepithelial cell disorganized, abnormal WT + MO1-scrib standard conditions Fig. 1 with image from Zigman et al., 2011
anatomical structure birc5a expression increased distribution, abnormal WT + MO1-scrib standard conditions Fig. S5 with image from Skouloudaki et al., 2009
head hemorrhagic, abnormal s843Tg + MO1-scrib standard conditions Fig. 5 from Michaelis et al., 2013
cranial vasculature malformed, abnormal s843Tg + MO1-scrib standard conditions Fig. 5 from Michaelis et al., 2013
intersegmental vessel decreased length, abnormal s843Tg + MO1-scrib standard conditions Fig. 5 from Michaelis et al., 2013
intersegmental vessel vasculature development delayed, abnormal s843Tg + MO1-scrib standard conditions Fig. 5 from Michaelis et al., 2013
convergent extension disrupted, abnormal AB + MO1-lpp + MO1-scrib standard conditions Fig. 6 with image from Vervenne et al., 2008
pronephros cystic, abnormal WT + MO1-nphp4 + MO1-scrib standard conditions Fig. 4 from Burcklé et al., 2011
neuroepithelial cell catenin complex spatial pattern, abnormal ctnna1ct3aGt + MO1-scrib standard conditions Fig. 3 with image from Zigman et al., 2011
secondary neural tube formation decreased process quality, abnormal ctnna1ct3aGt + MO1-scrib standard conditions Fig. 3 with image from Zigman et al., 2011
intersegmental vessel decreased length, abnormal s843Tg + MO1-scrib + MO5-itga5 standard conditions Fig. S9 from Michaelis et al., 2013
intersegmental vessel vasculature development delayed, abnormal s843Tg + MO1-scrib + MO5-itga5 standard conditions Fig. S9 from Michaelis et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.