header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050506-2
Morpholino Name: MO2-ift88
Target: ift88 (1)
Previous Names: MO2-ttc10 (1), polarisSP (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCAGATGCAAAATGACTCACTGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino targeting the ift88 gene.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ift88 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ift88
Expressed Gene Anatomy Figures
pax2a Fig. 8 with image from Gerlach et al., 2014
podxl Fig. 8 with image from Gerlach et al., 2014
wt1a Fig. 8 with image from Gerlach et al., 2014
PHENOTYPE
Phenotype resulting from MO2-ift88
Phenotype of all Fish created by or utilizing MO2-ift88
OTHER MO2-ift88 MORPHOLINO PAGESNo links to external sites
CITATIONS (5)