header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050503-2
Morpholino Name: MO2-her9
Target: her9 (1)
Sequence:
5' - GTGATTTTTACCTTTCTATGCTCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino was designed against a splice site.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-her9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-her9
Expressed Gene Anatomy Figures
atoh1a Fig. 3 with imageFig. S2 with image from Radosevic et al., 2011
cdkn1ba Fig. 4 with image from Radosevic et al., 2011
cdkn1ca Fig. 4 with image from Radosevic et al., 2011
egr2b Fig. 2 with image from Radosevic et al., 2011
her9 Fig. 2 with imageFig. 4 with imageFig. S2 with image from Radosevic et al., 2011
neurod1 Fig. 2 with image from Radosevic et al., 2011
neurod4 Fig. 2 with imageFig. S2 with image from Radosevic et al., 2011
neurog1 Fig. 2 with image from Radosevic et al., 2011
tbx1 Fig. 2 with image from Radosevic et al., 2011
PHENOTYPE
Phenotype resulting from MO2-her9
No data available

Phenotype of all Fish created by or utilizing MO2-her9
No data available
OTHER MO2-her9 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)