Morpholino

MO2-her9

ID
ZDB-MRPHLNO-050503-2
Name
MO2-her9
Previous Names
None
Target
Sequence
5' - GTGATTTTTACCTTTCTATGCTCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino was designed against a splice site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-her9
No data available
Phenotype
Phenotype resulting from MO2-her9
Phenotype Fish Figures
rhombomere cell division decreased rate, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 5 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary GFP expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 6 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary sox2 expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary cdkn1ca expression increased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 5 with image from Engel-Pizcueta et al., 2024
rhombomere lateral side sox2 expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere medial side sox2 expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere neuron GFP expression increased amount, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere neuron GFP expression spatial pattern, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere nucleus GFP expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 5 with image from Engel-Pizcueta et al., 2024
rhombomere nucleus mCherry expression increased amount, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere nucleus mCherry expression spatial pattern, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere regulation of neurogenesis decreased process quality, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere stem cell population maintenance decreased process quality, abnormal pfu103Tg/pfu103Tg + MO2-her9 Fig. 7 with image from Engel-Pizcueta et al., 2024
Phenotype of all Fish created by or utilizing MO2-her9
Phenotype Fish Conditions Figures
rhombomere medial side sox2 expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary sox2 expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere stem cell population maintenance decreased process quality, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere cell division decreased rate, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 5 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary GFP expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 6 with image from Engel-Pizcueta et al., 2024
rhombomere lateral side sox2 expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 7 with image from Engel-Pizcueta et al., 2024
rhombomere nucleus GFP expression decreased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 5 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary cdkn1ca expression increased amount, abnormal pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 5 with image from Engel-Pizcueta et al., 2024
rhombomere neuron GFP expression increased amount, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 standard conditions Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere nucleus mCherry expression spatial pattern, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 standard conditions Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere neuron GFP expression spatial pattern, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 standard conditions Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere nucleus mCherry expression increased amount, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 standard conditions Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere regulation of neurogenesis decreased process quality, abnormal knu3Tg/knu3Tg; pfu102Tg/pfu102Tg + MO2-her9 standard conditions Fig. 2 with image from Engel-Pizcueta et al., 2024
rhombomere compartment boundary GFP expression decreased amount, abnormal ccnd1pfu6/pfu6; pfu103Tg/pfu103Tg + MO2-her9 standard conditions Fig. 6 with image from Engel-Pizcueta et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.