Morpholino
MO2-cxcl12a
- ID
- ZDB-MRPHLNO-050324-1
- Name
- MO2-cxcl12a
- Previous Names
-
- S1a-3-MO (1)
- Target
- Sequence
-
5' - ATCACTTTGAGATCCATGTTTGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cxcl12a
No data available
Phenotype
Phenotype resulting from MO2-cxcl12a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-cxcl12a
1 - 5 of 17 Show all
Citations
- Wei, Z., Hong, Q., Ding, Z., Liu, J. (2023) cxcl12a plays an essential role in pharyngeal cartilage development. Frontiers in cell and developmental biology. 11:12432651243265
- Jiang, D., Jiang, Z., Lu, D., Wang, X., Liang, H., Zhang, J., Meng, Y., Li, Y., Wu, D., Huang, Y., Chen, Y., Deng, H., Wu, Q., Xiong, J., Meng, A., Yu, L. (2019) Migrasomes provide regional cues for organ morphogenesis during zebrafish gastrulation. Nature cell biology. 21:966-977
- Xu, H., Ye, D., Behra, M., Burgess, S., Chen, S., and Lin, F. (2014) Gbeta1 controls collective cell migration by regulating the protrusive activity of leader cells in the posterior lateral line primordium. Developmental Biology. 385(2):316-27
- Venkiteswaran, G., Lewellis, S.W., Wang, J., Reynolds, E., Nicholson, C., and Knaut, H. (2013) Generation and Dynamics of an Endogenous, Self-Generated Signaling Gradient across a Migrating Tissue. Cell. 155(3):674-687
- Gamba, L., Cubedo, N., Ghysen, A., Lutfalla, G., and Dambly-Chaudière, C. (2010) Estrogen receptor ESR1 controls cell migration by repressing chemokine receptor CXCR4 in the zebrafish posterior lateral line system. Proceedings of the National Academy of Sciences of the United States of America. 107(14):6358-6363
- Palevitch, O., Abraham, E., Borodovsky, N., Levkowitz, G., Zohar, Y., and Gothilf, Y. (2010) Cxcl12a-Cxcr4b signaling is important for proper development of the forebrain GnRH system in zebrafish. General and comparative endocrinology. 165(2):262-268
- Cubedo, N., Cerdan, E., Sapede, D., and Rossel, M. (2009) CXCR4 and CXCR7 cooperate during tangential migration of facial motoneurons. Molecular and cellular neurosciences. 40(4):474-484
- Aman, A., and Piotrowski, T. (2008) Wnt/beta-catenin and Fgf signaling control collective cell migration by restricting chemokine receptor expression. Developmental Cell. 15(5):749-761
- Yanicostas, C., Ernest, S., Dayraud, C., Petit, C., and Soussi-Yanicostas, N. (2008) Essential requirement for zebrafish anosmin-1a in the migration of the posterior lateral line primordium. Developmental Biology. 320(2):469-479
- Chong, S.W., Nguyet, L.M., Jiang, Y.J., and Korzh, V. (2007) The chemokine, Sdf-1, and its receptor, Cxcr4, are required for formation of muscle in zebrafish. BMC Developmental Biology. 7(1):54
1 - 10 of 14
Show