Morpholino

MO1-ptch2

ID
ZDB-MRPHLNO-050308-1
Name
MO1-ptch2
Previous Names
  • MO1-ptc1
  • ptc1 MO1 (1)
Target
Sequence
5' - CATAGTCCAAACGGGAGGCAGAAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptch2
No data available
Phenotype
Phenotype resulting from MO1-ptch2
Phenotype Fish Figures
brain morphology, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
central nervous system foxa expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
eye curved lateral, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
eye mislocalised medially, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
fast muscle cell increased amount, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
fast muscle cell mislocalised, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
lens displaced, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
muscle morphology, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
muscle pioneer increased amount, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
optic fissure closure incomplete, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
retina protruding, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
slow muscle cell increased amount, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
slow muscle cell mislocalised, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
smoothened signaling pathway disrupted, abnormal AB + MO1-ptch2 Fig. 2 from Wilson et al., 2009
somite hhip expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
somite foxa expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
somite nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
somite U-shaped, abnormal AB + MO1-ptch2 Fig. S10 from Wilson et al., 2009
somite muscle pioneer increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
Fig. S10 from Wilson et al., 2009
Phenotype of all Fish created by or utilizing MO1-ptch2
Phenotype Fish Conditions Figures
eye mislocalised medially, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite muscle pioneer increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
Fig. S10 from Wilson et al., 2009
somite foxa expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
lens displaced, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
brain morphology, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
optic fissure closure incomplete, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
central nervous system foxa expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
muscle morphology, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite U-shaped, abnormal AB + MO1-ptch2 standard conditions Fig. S10 from Wilson et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-ptch2 standard conditions Fig. 2 from Wilson et al., 2009
eye curved lateral, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
retina protruding, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite hhip expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
muscle pioneer mislocalised, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell mislocalised, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell mislocalised, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3Fig. 4 with image from Ochi et al., 2006
whole organism ptch2 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
fast muscle cell decreased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3 from Ochi et al., 2006
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3Fig. 4 with image from Ochi et al., 2006
whole organism hhip expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
whole organism foxa expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite U-shaped, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 4 with image from Ochi et al., 2006
whole organism gli1 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
adaxial cell dispersed, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell absent, abnormal smob641/b641 + MO1-ptch1 + MO1-ptch2 (AB) standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
fast muscle cell decreased amount, abnormal ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer absent, abnormal ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
Citations