Morpholino

MO4-neurog1

ID

ZDB-MRPHLNO-050301-2

Name

MO4-neurog1

Previous Names

Target

Sequence

5' - TATACGATCTCCATTGTTGATAACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-neurog1

Expressed Gene	Anatomy	Figures
ascl1a	thalamus anterior region ventral thalamus	Fig. 4 from Scholpp et al., 2009
atoh1b	otic sensory epithelium	Fig. 2 from Hans et al., 2013
cdh6	(not) otic vesicle neuroblast (sensu Vertebrata)	Fig. 2 , Fig. 4 from Hans et al., 2013
hmx3a	otic placode neuroblast (sensu Vertebrata)	Fig. 2 , Fig. 4 from Hans et al., 2013
irx1b	thalamus	Fig. 4 from Scholpp et al., 2009
isl1a	mesencephalic nucleus of trigeminal nerve nucleus of the caudal commissure (not) Rohon-Beard neuron	Fig. 5 from Dyer et al., 2014
myo7aa	immature anterior macula immature posterior macula	Fig. 2 from Hans et al., 2013
neurod1	(not) ectoderm (not) otic vesicle neuroblast (sensu Vertebrata) telencephalon postero-dorsal region	Fig. 2 , Fig. 4 from Hans et al., 2013 Fig. S6 from Yoshizawa et al., 2011
slc17a6b	neuron	Fig. 4 from Scholpp et al., 2009
sox2	neuromast	Fig. 8 from Hernandez et al., 2007
stm	ectoderm otic vesicle epithelium	Fig. 2 , Fig. 4 from Hans et al., 2013
tbx1	otic placode	Fig. 2 from Hans et al., 2013

Phenotype

Phenotype resulting from MO4-neurog1

Phenotype	Fish	Figures
neuromast mislocalised, abnormal	sqet20Et + MO4-neurog1	Fig. 8 from Hernandez et al., 2007
otic vesicle neuroblast (sensu Vertebrata) physical object quality, abnormal	AB + MO4-neurog1	Fig. 2 from Hans et al., 2013
otic vesicle neuroblast (sensu Vertebrata) poorly differentiated, abnormal	AB + MO4-neurog1	Fig. 2 from Hans et al., 2013
otic vesicle neuron differentiation decreased process quality, abnormal	AB + MO4-neurog1	Fig. 2 from Hans et al., 2013
posterior lateral line ganglion absent, abnormal	zf106Tg + MO4-neurog1	Fig. 3 from Sarrazin et al., 2010
Rohon-Beard neuron decreased amount, abnormal	WT + MO4-neurog1	Fig. 5 from Dyer et al., 2014

Phenotype of all Fish created by or utilizing MO4-neurog1

Phenotype	Fish	Conditions	Figures
otic vesicle neuron differentiation decreased process quality, abnormal	AB + MO4-neurog1	standard conditions	Fig. 2 from Hans et al., 2013
otic vesicle neuroblast (sensu Vertebrata) physical object quality, abnormal	AB + MO4-neurog1	standard conditions	Fig. 2 from Hans et al., 2013
otic vesicle neuroblast (sensu Vertebrata) poorly differentiated, abnormal	AB + MO4-neurog1	standard conditions	Fig. 2 from Hans et al., 2013
Rohon-Beard neuron decreased amount, abnormal	WT + MO4-neurog1	standard conditions	Fig. 5 from Dyer et al., 2014
neuromast mislocalised, abnormal	sqet20Et + MO4-neurog1	standard conditions	Fig. 8 from Hernandez et al., 2007
posterior lateral line ganglion absent, abnormal	zf106Tg + MO4-neurog1	standard conditions	Fig. 3 from Sarrazin et al., 2010
otic vesicle neurogenesis decreased process quality, abnormal	Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO4-neurog1	standard conditions	Fig. 4 from Hans et al., 2013
otic vesicle morphogenesis decreased process quality, abnormal	Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO4-neurog1	standard conditions	Fig. 4 from Hans et al., 2013
otic vesicle malformed, abnormal	Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO4-neurog1	standard conditions	Fig. 4 from Hans et al., 2013

Citations