Morpholino
MO2-tp63
- ID
- ZDB-MRPHLNO-050204-5
- Name
- MO2-tp63
- Previous Names
- Target
- Sequence
-
5' - CCCTAGTTTTCTTCCTTTTATCCCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tp63
Expressed Gene | Anatomy | Figures |
---|---|---|
llgl2 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO2-tp63
Phenotype | Fish | Figures |
---|---|---|
periderm cell decreased amount, abnormal | WT + MO2-tp63 |
Fig. 5 ![]() |
peridermal cell increased size, abnormal | zf106Tg + MO2-tp63 |
Fig. 5 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-tp63
1 - 5 of 5
Citations
- Armistead, J., Höpfl, S., Goldhausen, P., Müller-Hartmann, A., Fahle, E., Hatzold, J., Franzen, R., Brodesser, S., Radde, N.E., Hammerschmidt, M. (2024) A sphingolipid rheostat controls apoptosis versus apical cell extrusion as alternative tumour-suppressive mechanisms. Cell Death & Disease. 15:746746
- Gupta, K., Mukherjee, S., Sen, S., Sonawane, M. (2022) Coordinated activities of Myosin Vb isoforms and mTOR signaling regulate epithelial cell morphology during development. Development (Cambridge, England). 149(6)
- Sonal, ., Sidhaye, J., Phatak, M., Banerjee, S., Mulay, A., Deshpande, O., Bhide, S., Jacob, T., Gehring, I., Nuesslein-Volhard, C., Sonawane, M. (2014) Myosin Vb Mediated Plasma Membrane Homeostasis Regulates Peridermal Cell Size and Maintains Tissue Homeostasis in the Zebrafish Epidermis. PLoS Genetics. 10:e1004614
- Jänicke, M., Renisch, B., and Hammerschmidt, M. (2010) Zebrafish grainyhead-like1 is a common marker of different non-keratinocyte epidermal cell lineages, which segregate from each other in a Foxi3-dependent manner. The International journal of developmental biology. 54(5):837-850
- Jänicke, M., Carney, T.J., and Hammerschmidt, M. (2007) Foxi3 transcription factors and Notch signaling control the formation of skin ionocytes from epidermal precursors of the zebrafish embryo. Developmental Biology. 307(2):258-271
- Nowak, M., Köster, C., and Hammerschmidt, M. (2005) Perp is required for tissue-specific cell survival during zebrafish development. Cell death and differentiation. 12(1):52-64
- Bakkers, J., Hild, M., Kramer, C., Furutani-Seiki, M., and Hammerschmidt, M. (2002) Zebrafish Delta Np63 is a direct target of Bmp signaling and encodes a transcriptional repressor blocking neural specification in the ventral ectoderm. Developmental Cell. 2(5):617-627
1 - 7 of 7
Show