Morpholino
MO1-nkx6.1
- ID
- ZDB-MRPHLNO-050201-3
- Name
- MO1-nkx6.1
- Previous Names
-
- nkx6.1-MO (1)
- Target
- Sequence
-
5' - CGCAAGAAGAAGGACAGTGACCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Blocks translation.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nkx6.1
Expressed Gene | Anatomy | Figures |
---|---|---|
alcama |
Fig. 8 ![]() |
|
isl1a |
Fig. 2 ![]() Fig. 8 ![]() |
|
isl2a |
Fig. 2 ![]() |
Phenotype
Phenotype resulting from MO1-nkx6.1
Phenotype of all Fish created by or utilizing MO1-nkx6.1
Citations
- Seredick, S., Van Ryswyk, L., Hutchinson, S.A., and Eisen, J.S. (2012) Zebrafish Mnx proteins specify one motoneuron subtype and suppress acquisition of interneuron characteristics. Neural Development. 7(1):35
- Binot, A.C., Manfroid, I., Flasse, L., Winandy, M., Motte, P., Martial, J.A., Peers, B., and Voz, M.L. (2010) Nkx6.1 and nkx6.2 regulate alpha- and beta-cell formation in zebrafish by acting on pancreatic endocrine progenitor cells. Developmental Biology. 340(2):397-407
- Hutchinson, S.A., Cheesman, S.E., Hale, L.A., Boone, J.Q., and Eisen, J.S. (2007) Nkx6 proteins specify one zebrafish primary motoneuron subtype by regulating late islet1 expression. Development (Cambridge, England). 134(9):1671-1677
- Cheesman, S.E., Layden, M.J., Von Ohlen, T., Doe, C.Q., and Eisen, J.S. (2004) Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and regulate motoneuron formation. Development (Cambridge, England). 131(21):5221-5232
1 - 4 of 4
Show