ZFIN ID: ZDB-MRPHLNO-050107-2
Morpholino Name: MO1-tp73
Target: tp73
Previous Name: MO1 TAp73 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGATGTTGGACAATCCACCGCAGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tp73 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tp73
Expressed Gene Anatomy Figures
perp text only from Nowak et al., 2005
tp73 Fig. 6 with image from Rentzsch et al., 2003
PHENOTYPE
Phenotype resulting from MO1-tp73
Phenotype Figures
basibranchial decreased size, abnormal Fig. 6 with image from Rentzsch et al., 2003
basibranchial undulate, abnormal Fig. 6 with image from Rentzsch et al., 2003
basihyal cartilage decreased size, abnormal Fig. 6 with image from Rentzsch et al., 2003
basihyal cartilage undulate, abnormal Fig. 6 with image from Rentzsch et al., 2003
ceratobranchial cartilage decreased size, abnormal Fig. 6 with image from Rentzsch et al., 2003
ceratohyal cartilage displaced, abnormal Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage malformed, abnormal Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage shape, abnormal Fig. 6 with image from Rentzsch et al., 2003
hyosymplectic cartilage mislocalised posteriorly, abnormal Fig. 6 with image from Rentzsch et al., 2003
olfactory placode morphology, abnormal Fig. 6 with image from Rentzsch et al., 2003
palatoquadrate cartilage mislocalised posteriorly, abnormal Fig. 6 with image from Rentzsch et al., 2003
telencephalon morphology, abnormal Fig. 6 with image from Rentzsch et al., 2003
telencephalon development disrupted, abnormal Fig. 6 with image from Rentzsch et al., 2003

Phenotype of all Fish created by or utilizing MO1-tp73
Phenotype Fish Conditions Figures
basihyal cartilage decreased size, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
basibranchial decreased size, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
telencephalon morphology, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
basibranchial undulate, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage malformed, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
ceratohyal cartilage displaced, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
palatoquadrate cartilage mislocalised posteriorly, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage shape, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
basihyal cartilage undulate, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
hyosymplectic cartilage mislocalised posteriorly, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
telencephalon development disrupted, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
olfactory placode morphology, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
ceratobranchial cartilage decreased size, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
eye decreased size, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
whole organism edematous, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3Fig. 4 from Davidson et al., 2008
splanchnocranium morphology, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
inner ear decreased size, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
brain decreased size, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
renal system process disrupted, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 5 from Davidson et al., 2008
head morphology, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
splanchnocranium morphology, abnormal WT + MO1-tp73 + MO2-tp73 + MO4-tp53 standard conditions Fig. 3 from Davidson et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-tp73 + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-tp73 + MO2-chek1 + MO3-tp63 radiation Fig. 4 with image from Sidi et al., 2008
OTHER MO1-tp73 MORPHOLINO PAGESNo links to external sites
CITATIONS (6)