Morpholino

MO1-tp73

ID
ZDB-MRPHLNO-050107-2
Name
MO1-tp73
Previous Names
  • MO1 TAp73 (1)
Target
Sequence
5' - GGATGTTGGACAATCCACCGCAGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tp73
Expressed Gene Anatomy Figures
perp text only from Nowak et al., 2005
tp73 Fig. 6 with image from Rentzsch et al., 2003
Phenotype
Phenotype resulting from MO1-tp73
Phenotype Fish Figures
basibranchial decreased size, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
basibranchial undulate, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
basihyal cartilage decreased size, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
basihyal cartilage undulate, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
ceratobranchial cartilage decreased size, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
ceratohyal cartilage displaced, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage malformed, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage shape, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
hyosymplectic cartilage mislocalised posteriorly, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
olfactory placode morphology, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
palatoquadrate cartilage mislocalised posteriorly, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
telencephalon morphology, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
telencephalon development disrupted, abnormal WT + MO1-tp73 Fig. 6 with image from Rentzsch et al., 2003
Phenotype of all Fish created by or utilizing MO1-tp73
Phenotype Fish Conditions Figures
basihyal cartilage decreased size, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
basibranchial decreased size, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
telencephalon morphology, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
basibranchial undulate, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage malformed, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
ceratohyal cartilage displaced, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
palatoquadrate cartilage mislocalised posteriorly, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
cranial cartilage shape, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
basihyal cartilage undulate, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
hyosymplectic cartilage mislocalised posteriorly, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
telencephalon development disrupted, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
olfactory placode morphology, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
ceratobranchial cartilage decreased size, abnormal WT + MO1-tp73 standard conditions Fig. 6 with image from Rentzsch et al., 2003
eye decreased size, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
whole organism edematous, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3,  Fig. 4 from Davidson et al., 2008
splanchnocranium morphology, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
inner ear decreased size, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
brain decreased size, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
renal system process disrupted, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 5 from Davidson et al., 2008
head morphology, abnormal WT + MO1-tp73 + MO2-tp73 standard conditions Fig. 3 from Davidson et al., 2008
splanchnocranium morphology, abnormal WT + MO1-tp73 + MO2-tp73 + MO4-tp53 standard conditions Fig. 3 from Davidson et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-tp73 + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-tp73 + MO2-chek1 + MO3-tp63 radiation Fig. 4 with image from Sidi et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.