Morpholino
MO1-tp73
- ID
- ZDB-MRPHLNO-050107-2
- Name
- MO1-tp73
- Previous Names
-
- MO1 TAp73 (1)
- Target
- Sequence
-
5' - GGATGTTGGACAATCCACCGCAGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tp73
No data available
Phenotype
Phenotype resulting from MO1-tp73
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-tp73
1 - 5 of 23 Show all
Citations
- Pyati, U.J., Gjini, E., Carbonneau, S., Lee, J.S., Guo, F., Jette, C.A., Kelsell, D.P., and Look, A.T. (2011) p63 Mediates an Apoptotic Response to Pharmacological and Disease-Related ER Stress in the Developing Epidermis. Developmental Cell. 21(3):492-505
- Davidson, W., Ren, Q., Kari, G., Kashi, O., Dicker, A.P., and Rodeck, U. (2008) Inhibition of p73 function by Pifithrin-α as revealed by studies in zebrafish embryos. Cell cycle (Georgetown, Tex.). 7(9):1224-1230
- Sidi, S., Sanda, T., Kennedy, R.D., Hagen, A.T., Jette, C.A., Hoffmans, R., Pascual, J., Imamura, S., Kishi, S., Amatruda, J.F., Kanki, J.P., Green, D.R., D'Andrea, A.A., and Look, A.T. (2008) Chk1 Suppresses a Caspase-2 Apoptotic Response to DNA Damage that Bypasses p53, Bcl-2, and Caspase-3. Cell. 133(5):864-877
- Nowak, M., Köster, C., and Hammerschmidt, M. (2005) Perp is required for tissue-specific cell survival during zebrafish development. Cell death and differentiation. 12(1):52-64
- Rentzsch, F., Kramer, C., and Hammerschmidt, M. (2003) Specific and conserved roles of TAp73 during zebrafish development. Gene. 323:19-30
1 - 5 of 5
Show