Morpholino

MO1-bmp2b

ID

ZDB-MRPHLNO-041217-6

Name

MO1-bmp2b

Previous Names

bmp2b MO (1)
bmp2bmorph (1)

Target

bmp2b (1)

Sequence

5' - CGCGGACCACGGCGACCATGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

MODB:78 (2)

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bmp2b

Expressed Gene	Anatomy	Figures
admp	shield	Fig. 4 from Yan et al., 2019
chrd	shield	Fig. 6 from Yan et al., 2019
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 5 from Rentzsch et al., 2006 Fig. 1 from Lele et al., 2001
eve1	margin anterior region mesoderm (not) whole organism	Fig. 6 from Yan et al., 2019 Fig. 2 from von der Hardt et al., 2007 Fig. 3 from Rentzsch et al., 2006
gata1a	whole organism	Fig. S2 from von der Hardt et al., 2007
pcdh8	mesoderm	Fig. 2 from von der Hardt et al., 2007
pnhd	margin anterior region	Fig. 4 from Yan et al., 2019
spaw	lateral plate mesoderm	Fig. 7 from Chocron et al., 2007
szl	whole organism	Fig. S2 from von der Hardt et al., 2007
tbx6	mesoderm	Fig. 2 from von der Hardt et al., 2007

Phenotype

Phenotype resulting from MO1-bmp2b

Phenotype	Fish	Figures
dorsal convergence disrupted, abnormal	WT + MO1-bmp2b	Fig. 1 , Fig. 4 from von der Hardt et al., 2007
lateral mesoderm mislocalised, abnormal	WT + MO1-bmp2b	Fig. 1 from von der Hardt et al., 2007
margin anterior region pnhd expression decreased distribution, abnormal	TU + MO1-bmp2b	Fig. 4 from Yan et al., 2019
rhombomere 3 left side fused with rhombomere 3 right side, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
rhombomere 5 left side fused with rhombomere 5 right side, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
shield admp expression increased distribution, abnormal	TU + MO1-bmp2b	Fig. 4 from Yan et al., 2019
somite circular, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
somite fused with somite, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal	WT + MO1-bmp2b	Fig. S4 from Miyares et al., 2013 Fig. 3 from Chen et al., 2012 Fig. 1 from Lele et al., 2001
yolk broken, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
yolk protruding, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001

Phenotype of all Fish created by or utilizing MO1-bmp2b

Phenotype	Fish	Conditions	Figures
margin anterior region pnhd expression decreased distribution, abnormal	TU + MO1-bmp2b	standard conditions	Fig. 4 from Yan et al., 2019
shield admp expression increased distribution, abnormal	TU + MO1-bmp2b	standard conditions	Fig. 4 from Yan et al., 2019
rhombomere 3 left side fused with rhombomere 3 right side, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal	WT + MO1-bmp2b	standard conditions	Fig. S4 from Miyares et al., 2013 Fig. 1 from Lele et al., 2001
lateral mesoderm mislocalised, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from von der Hardt et al., 2007
somite fused with somite, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
somite circular, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
rhombomere 5 left side fused with rhombomere 5 right side, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
yolk broken, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
yolk protruding, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
dorsal convergence disrupted, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 , Fig. 4 from von der Hardt et al., 2007
whole organism wholly dorsalized, abnormal	t32231Tg + MO1-bmp2b	standard conditions	Fig. 3 from Chen et al., 2012
whole organism posterior region malformed, exacerbated	admp^ioz10/ioz10; pnhd^ioz11/ioz11 + MO1-bmp2b (TU)	standard conditions	Fig. 6 from Yan et al., 2019
margin anterior region eve1 expression decreased distribution, abnormal	admp^ioz10/ioz10; pnhd^ioz11/ioz11 + MO1-bmp2b (TU)	standard conditions	Fig. 6 from Yan et al., 2019
shield chrd expression increased distribution, abnormal	admp^ioz10/ioz10; pnhd^ioz11/ioz11 + MO1-bmp2b (TU)	standard conditions	Fig. 6 from Yan et al., 2019

Citations