Morpholino

MO1-bmp2b

ID
ZDB-MRPHLNO-041217-6
Name
MO1-bmp2b
Previous Names
  • bmp2b MO (1)
  • bmp2bmorph (1)
Target
Sequence
5' - CGCGGACCACGGCGACCATGATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmp2b
Phenotype
Phenotype resulting from MO1-bmp2b
Phenotype of all Fish created by or utilizing MO1-bmp2b
Phenotype Fish Conditions Figures
margin anterior region pnhd expression decreased distribution, abnormal TU + MO1-bmp2b standard conditions Fig. 4 from Yan et al., 2019
shield admp expression increased distribution, abnormal TU + MO1-bmp2b standard conditions Fig. 4 from Yan et al., 2019
rhombomere 3 left side fused with rhombomere 3 right side, abnormal WT + MO1-bmp2b standard conditions Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal WT + MO1-bmp2b standard conditions Fig. S4 with image from Miyares et al., 2013
Fig. 1 from Lele et al., 2001
lateral mesoderm mislocalised, abnormal WT + MO1-bmp2b standard conditions Fig. 1 with image from von der Hardt et al., 2007
somite circular, abnormal WT + MO1-bmp2b standard conditions Fig. 1 from Lele et al., 2001
somite fused with somite, abnormal WT + MO1-bmp2b standard conditions Fig. 1 from Lele et al., 2001
rhombomere 5 left side fused with rhombomere 5 right side, abnormal WT + MO1-bmp2b standard conditions Fig. 1 from Lele et al., 2001
yolk broken, abnormal WT + MO1-bmp2b standard conditions Fig. 1 from Lele et al., 2001
dorsal convergence disrupted, abnormal WT + MO1-bmp2b standard conditions Fig. 1 with imageFig. 4 with image from von der Hardt et al., 2007
yolk protruding, abnormal WT + MO1-bmp2b standard conditions Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal t32231Tg + MO1-bmp2b standard conditions Fig. 3 with image from Chen et al., 2012
whole organism posterior region malformed, exacerbated admpioz10/ioz10; pnhdioz11/ioz11 + MO1-bmp2b standard conditions Fig. 6 from Yan et al., 2019
margin anterior region eve1 expression decreased distribution, abnormal admpioz10/ioz10; pnhdioz11/ioz11 + MO1-bmp2b standard conditions Fig. 6 from Yan et al., 2019
shield chrd expression increased distribution, abnormal admpioz10/ioz10; pnhdioz11/ioz11 + MO1-bmp2b standard conditions Fig. 6 from Yan et al., 2019
Citations