Morpholino

MO1-dact2

ID
ZDB-MRPHLNO-041217-3
Name
MO1-dact2
Previous Names
  • dpr2MO (1)
Target
Sequence
5' - TCAGACGTGCCGTTTAGACATATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dact2
No data available
Phenotype
Phenotype resulting from MO1-dact2
Phenotype Fish Figures
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact2 Fig. 3 with image,  Fig. 5 with image from Waxman et al., 2004
eye decreased distance eye, abnormal WT + MO1-dact2 Fig. 5 with image from Waxman et al., 2004
eye decreased size, abnormal AB + MO1-dact2 Fig. 5,  Fig. S8 from Yi et al., 2020
eye decreased width, abnormal WT + MO1-dact2 Fig. 5 with image from Waxman et al., 2004
eye mislocalised anteriorly, abnormal WT + MO1-dact2 Fig. 5 with image from Waxman et al., 2004
eye photoreceptor cell photoreceptor disc membrane disorganized, abnormal AB + MO1-dact2 Fig. 5 from Yi et al., 2020
notochord increased width, abnormal WT + MO1-dact2 Fig. 3 with image from Waxman et al., 2004
somite flat, abnormal WT + MO1-dact2 Fig. 5 with image from Waxman et al., 2004
somite increased width, abnormal WT + MO1-dact2 Fig. 3 with image from Waxman et al., 2004
whole organism decreased length, abnormal WT + MO1-dact2 Fig. 5,  Fig. S8 from Yi et al., 2020
Fig. 5 with image from Waxman et al., 2004
whole organism decreased size, abnormal WT + MO1-dact2 Fig. 3 with image from Waxman et al., 2004
Phenotype of all Fish created by or utilizing MO1-dact2
Phenotype Fish Conditions Figures
eye photoreceptor cell photoreceptor disc membrane disorganized, abnormal AB + MO1-dact2 standard conditions Fig. 5 from Yi et al., 2020
eye decreased size, abnormal AB + MO1-dact2 standard conditions Fig. 5,  Fig. S8 from Yi et al., 2020
whole organism decreased length, abnormal AB + MO1-dact2 standard conditions Fig. 5,  Fig. S8 from Yi et al., 2020
whole organism decreased size, abnormal WT + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
notochord increased width, abnormal WT + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
whole organism decreased length, abnormal WT + MO1-dact2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye decreased width, abnormal WT + MO1-dact2 standard conditions Fig. 5 with image from Waxman et al., 2004
somite increased width, abnormal WT + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
eye decreased distance eye, abnormal WT + MO1-dact2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye mislocalised anteriorly, abnormal WT + MO1-dact2 standard conditions Fig. 5 with image from Waxman et al., 2004
somite flat, abnormal WT + MO1-dact2 standard conditions Fig. 5 with image from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact2 standard conditions Fig. 3 with image,  Fig. 5 with image from Waxman et al., 2004
whole organism decreased length, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
diencephalon decreased size, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
somite increased width, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
notochord increased width, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
whole organism decreased size, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
midbrain decreased size, abnormal WT + MO1-dact1 + MO1-dact2 standard conditions Fig. 3 with image from Waxman et al., 2004
whole organism decreased length, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye decreased distance eye, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
somite flat, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye decreased width, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye fused with eye, abnormal WT + MO1-dact2 + MO1-wnt11f2 standard conditions Fig. 5 with image from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact2 + MO1-wnt11f2 standard conditions Fig. 5 with image from Waxman et al., 2004
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.