Morpholino

MO1-ntn1a

ID

ZDB-MRPHLNO-041214-1

Name

MO1-ntn1a

Previous Names

Target

Sequence

5' - CGCCTTCCTCAGCCTCTCCTGTGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

designed to block translation of Netrin-1a mRNA, complementary to bases –8 to –32 of Netrin-1a 5’UTR

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ntn1a

No data available

Phenotype

Phenotype resulting from MO1-ntn1a

Phenotype	Fish	Figures
activation of cysteine-type endopeptidase activity involved in apoptotic process increased process quality, abnormal	y1Tg + MO1-ntn1a	Fig. 7 from Guenebeaud et al., 2010
apoptotic process increased occurrence, abnormal	y1Tg + MO1-ntn1a	Fig. 3 from Castets et al., 2009
embryo development disrupted, abnormal	y1Tg + MO1-ntn1a	Fig. 3 from Castets et al., 2009
intersegmental vessel disorganized, abnormal	y1Tg + MO1-ntn1a	Fig. 7 from Guenebeaud et al., 2010 Fig. 3 from Castets et al., 2009
whole organism lacks all parts of type dorsal longitudinal anastomotic vessel, abnormal	y1Tg + MO1-ntn1a	Fig. 3 from Castets et al., 2009
whole organism lacks parts or has fewer parts of type intersegmental vessel, abnormal	y1Tg + MO1-ntn1a	Fig. 3 from Castets et al., 2009

Phenotype of all Fish created by or utilizing MO1-ntn1a

Phenotype	Fish	Conditions	Figures
embryo development disrupted, abnormal	y1Tg + MO1-ntn1a	standard conditions	Fig. 3 from Castets et al., 2009
whole organism lacks parts or has fewer parts of type intersegmental vessel, abnormal	y1Tg + MO1-ntn1a	standard conditions	Fig. 3 from Castets et al., 2009
whole organism lacks all parts of type dorsal longitudinal anastomotic vessel, abnormal	y1Tg + MO1-ntn1a	standard conditions	Fig. 3 from Castets et al., 2009
activation of cysteine-type endopeptidase activity involved in apoptotic process increased process quality, abnormal	y1Tg + MO1-ntn1a	standard conditions	Fig. 7 from Guenebeaud et al., 2010
intersegmental vessel disorganized, abnormal	y1Tg + MO1-ntn1a	standard conditions	Fig. 7 from Guenebeaud et al., 2010 Fig. 3 from Castets et al., 2009
apoptotic process increased occurrence, abnormal	y1Tg + MO1-ntn1a	standard conditions	Fig. 3 from Castets et al., 2009
whole organism has fewer parts of type intersegmental vessel, abnormal	y1Tg + MO1-ntn1a + MO1-unc5b	standard conditions	Fig. 3 from Castets et al., 2009

Citations