Morpholino
MO1-dlx4b
- ID
- ZDB-MRPHLNO-041110-1
- Name
- MO1-dlx4b
- Previous Names
-
- mo-1-dlx4b
- Target
- Sequence
-
5' - GCCCGATGATGGTCTGAGTGCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dlx4b
No data available
Phenotype
Phenotype resulting from MO1-dlx4b
No data available
Phenotype of all Fish created by or utilizing MO1-dlx4b
from 1 - 4 of 4
Citations
- Ezhkova, D., Schwarzer, S., Spieß, S., Geffarth, M., Machate, A., Zöller, D., Stucke, J., Alexopoulou, D., Lesche, M., Dahl, A., Hans, S. (2023) Transcriptome analysis reveals an Atoh1b-dependent gene set downstream of Dlx3b/4b during early inner ear development in zebrafish. Biology Open. 12(6):
- Sun, P., Zhang, Y., Zhao, F., Wu, J.P., Pun, S.H., Peng, C., Du, M., Vai, M.I., Liu, D., Chen, F. (2018) An Assay for Systematically Quantifying the Vestibulo-Ocular Reflex to Assess Vestibular Function in Zebrafish Larvae. Frontiers in Cellular Neuroscience. 12:257
- Hans, S., Irmscher, A., and Brand, M. (2013) Zebrafish Foxi1 provides a neuronal ground state during inner ear induction preceding the Dlx3b/4b-regulated sensory lineage. Development (Cambridge, England). 140(9):1936-1945
- Dutta, S., Dietrich, J.E., Aspock, G., Burdine, R.D., Schier, A., Westerfield, M., and Varga, Z.M. (2005) pitx3 defines an equivalence domain for lens and anterior pituitary placode. Development (Cambridge, England). 132(7):1579-1590
- Liu, D., Chu, H., Maves, L., Yan, Y.-L., Morcos, P.A., Postlethwait, J.H., and Westerfield, M. (2003) Fgf3 and Fgf8 dependent and independent transcription factors are required for otic placode specification. Development (Cambridge, England). 130(10):2213-2224
1 - 5 of 5
Show