ZFIN ID: ZDB-MRPHLNO-041110-1
Morpholino Name: MO1-dlx4b
Target: dlx4b (1)
Previous Name: mo-1-dlx4b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCCGATGATGGTCTGAGTGCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dlx4b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dlx4b No data available
PHENOTYPE
Phenotype resulting from MO1-dlx4b
No data available

Phenotype of all Fish created by or utilizing MO1-dlx4b
Genome Resources:
CITATIONS (4)