CRISPR

CRISPR1-crybb2

ID
ZDB-CRISPR-260819-1
Name
CRISPR1-crybb2
Previous Names
None
Target
Sequence
5' - TCTCATATTTCTGTCACAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
View all 11 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
scu201 crybb2
Expression
Gene expression in Wild Types + CRISPR1-crybb2
No data available
Phenotype
Phenotype resulting from CRISPR1-crybb2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-crybb2
Phenotype Fish Conditions Figures
lens fiber cell lysosome increased amount, abnormal crybb2scu201/+ (AB) standard conditions Figure 3. with image from Wei et al., 2026
locomotory exploration behavior decreased process quality, abnormal crybb2scu201/+ (AB) control Fig. S6,  Figure 2. with image from Wei et al., 2026
whole organism viability, abnormal crybb2scu201/+ (AB) standard conditions Figure 2. with image from Wei et al., 2026
hyaloid vessel blood vessel endothelium structurally discontinuous, abnormal crybb2scu201/+ (AB) standard conditions Figure 4. with image from Wei et al., 2026
hyaloid vessel Ab8-kdrl labeling decreased distribution, abnormal crybb2scu201/+ (AB) standard conditions Figure 4. with image from Wei et al., 2026
eye decreased diameter, abnormal crybb2scu201/+ (AB) standard conditions Figure 2. with image from Wei et al., 2026
lens decreased diameter, abnormal crybb2scu201/+ (AB) standard conditions Figure 2. with image from Wei et al., 2026
lens fiber cell zl-1 labeling spatial pattern, abnormal crybb2scu201/+ (AB) standard conditions Figure 3. with image from Wei et al., 2026
lens fiber cell mitochondrion increased amount, abnormal crybb2scu201/+ (AB) standard conditions Figure 3. with image from Wei et al., 2026
hyaloid vessel Ab8-kdrl labeling spatial pattern, abnormal crybb2scu201/+ (AB) standard conditions Figure 4. with image from Wei et al., 2026
lens fiber cell Ab2-mip labeling spatial pattern, abnormal crybb2scu201/+ (AB) standard conditions Figure 3. with image from Wei et al., 2026
lens central region opaque, abnormal crybb2scu201/+ (AB) standard conditions Figure 3. with image from Wei et al., 2026
swimming behavior decreased process quality, abnormal crybb2scu201/+ (AB) control Fig. S6,  Figure 2. with image from Wei et al., 2026
hyaloid vessel disoriented, abnormal crybb2scu201/+; s843Tg (AB) standard conditions Figure 4. with image from Wei et al., 2026
hyaloid vessel decreased permeability, abnormal crybb2scu201/+; s843Tg (AB) standard conditions Figure 4. with image from Wei et al., 2026
hyaloid vessel decreased branchiness, abnormal crybb2scu201/+; s843Tg (AB) standard conditions Figure 4. with image from Wei et al., 2026
hyaloid vessel sparse, abnormal crybb2scu201/+; s843Tg (AB) standard conditions Figure 4. with image from Wei et al., 2026
hyaloid vessel EGFP expression spatial pattern, abnormal crybb2scu201/+; s843Tg (AB) standard conditions Figure 4. with image from Wei et al., 2026
hyaloid vessel area density, abnormal crybb2scu201/+; s843Tg (AB) standard conditions Figure 4. with image from Wei et al., 2026
Citations