CRISPR

CRISPR1-crybb2

ID

ZDB-CRISPR-260819-1

Name

CRISPR1-crybb2

Previous Names

None

Target

crybb2 (1)

Sequence

5' - TCTCATATTTCTGTCACAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
scu201	crybb2

Expression

Gene expression in Wild Types + CRISPR1-crybb2

No data available

Phenotype

Phenotype resulting from CRISPR1-crybb2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-crybb2

Phenotype	Fish	Conditions	Figures
lens fiber cell lysosome increased amount, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 3. from Wei et al., 2026
locomotory exploration behavior decreased process quality, abnormal	crybb2^scu201/+ (AB)	control	Fig. S6, Figure 2. from Wei et al., 2026
whole organism viability, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 2. from Wei et al., 2026
hyaloid vessel blood vessel endothelium structurally discontinuous, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 4. from Wei et al., 2026
hyaloid vessel Ab8-kdrl labeling decreased distribution, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 4. from Wei et al., 2026
eye decreased diameter, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 2. from Wei et al., 2026
lens decreased diameter, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 2. from Wei et al., 2026
lens fiber cell zl-1 labeling spatial pattern, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 3. from Wei et al., 2026
lens fiber cell mitochondrion increased amount, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 3. from Wei et al., 2026
hyaloid vessel Ab8-kdrl labeling spatial pattern, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 4. from Wei et al., 2026
lens fiber cell Ab2-mip labeling spatial pattern, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 3. from Wei et al., 2026
lens central region opaque, abnormal	crybb2^scu201/+ (AB)	standard conditions	Figure 3. from Wei et al., 2026
swimming behavior decreased process quality, abnormal	crybb2^scu201/+ (AB)	control	Fig. S6, Figure 2. from Wei et al., 2026
hyaloid vessel disoriented, abnormal	crybb2^scu201/+; s843Tg (AB)	standard conditions	Figure 4. from Wei et al., 2026
hyaloid vessel decreased permeability, abnormal	crybb2^scu201/+; s843Tg (AB)	standard conditions	Figure 4. from Wei et al., 2026
hyaloid vessel decreased branchiness, abnormal	crybb2^scu201/+; s843Tg (AB)	standard conditions	Figure 4. from Wei et al., 2026
hyaloid vessel sparse, abnormal	crybb2^scu201/+; s843Tg (AB)	standard conditions	Figure 4. from Wei et al., 2026
hyaloid vessel EGFP expression spatial pattern, abnormal	crybb2^scu201/+; s843Tg (AB)	standard conditions	Figure 4. from Wei et al., 2026
hyaloid vessel area density, abnormal	crybb2^scu201/+; s843Tg (AB)	standard conditions	Figure 4. from Wei et al., 2026

Citations