CRISPR

CRISPR5-vgll4b

ID
ZDB-CRISPR-260817-4
Name
CRISPR5-vgll4b
Previous Names
None
Target
Sequence
5' - GCAGTCAGCAACCACCGGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns23 vgll4b
Expression
Gene expression in Wild Types + CRISPR5-vgll4b
No data available
Phenotype
Phenotype resulting from CRISPR5-vgll4b
No data available
Phenotype of all Fish created by or utilizing CRISPR5-vgll4b
Phenotype Fish Conditions Figures
posterior lateral line primordium ab1-ctnnb labeling spatial pattern, abnormal fu16Tg/fu16Tg; mw50Tg/mw50Tg + CRISPR4-vgll4b + CRISPR5-vgll4b standard conditions Fig. 6 with image from Lardennois et al., 2026
posterior lateral line primordium d2EGFP expression increased amount, abnormal fu16Tg/fu16Tg; mw50Tg/mw50Tg + CRISPR4-vgll4b + CRISPR5-vgll4b standard conditions Fig. 6 with image from Lardennois et al., 2026
posterior lateral line primordium EGFP expression increased amount, abnormal vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Lardennois et al., 2026
posterior lateral line homeostasis of number of cells within a tissue decreased process quality, abnormal vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Lardennois et al., 2026
posterior lateral line primordium EGFP expression increased amount, abnormal vgll4lfu93/+; vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 3 with image from Lardennois et al., 2026
posterior lateral line homeostasis of number of cells within a tissue decreased process quality, abnormal vgll4lfu93/+; vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 3 with image from Lardennois et al., 2026
posterior lateral line primordium EGFP expression increased amount, abnormal vgll4lfu93/fu93; vgll4bbns23/+; zf106Tg/zf106Tg standard conditions Fig. 3 with image from Lardennois et al., 2026
posterior lateral line homeostasis of number of cells within a tissue decreased process quality, abnormal vgll4lfu93/fu93; vgll4bbns23/+; zf106Tg/zf106Tg standard conditions Fig. 3 with image from Lardennois et al., 2026
posterior lateral line primordium hmx2 expression increased amount, abnormal vgll4lfu93/fu93; vgll4bbns23/bns23 standard conditions Fig. 9 with image from Lardennois et al., 2026
posterior lateral line primordium EGFP expression increased amount, abnormal vgll4lfu93/fu93; vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 8 with image from Lardennois et al., 2026
posterior lateral line primordium EGFP expression spatial pattern, abnormal vgll4lfu93/fu93; vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 8 with image from Lardennois et al., 2026
posterior lateral line primordium cell division increased occurrence, abnormal vgll4lfu93/fu93; vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 8 with image from Lardennois et al., 2026
posterior lateral line homeostasis of number of cells within a tissue decreased process quality, abnormal vgll4lfu93/fu93; vgll4bbns23/bns23; zf106Tg/zf106Tg standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Lardennois et al., 2026
Citations