CRISPR

CRISPR4-stc2a

ID
ZDB-CRISPR-260306-1
Name
CRISPR4-stc2a
Previous Names
None
Target
Sequence
5' - GCTGCTGCTCTCCGTATTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mi614 stc2a
mi615 stc2a
Expression
Gene expression in Wild Types + CRISPR4-stc2a
No data available
Phenotype
Phenotype resulting from CRISPR4-stc2a
No data available
Phenotype of all Fish created by or utilizing CRISPR4-stc2a
Phenotype Fish Conditions Figures
whole organism increased length, abnormal stc2ami614/mi614 standard conditions Figure 3 with image from Wang et al., 2026
whole organism length, ameliorated stc2ami614/mi614 chemical treatment by environment: U0126 Figure 4 with image from Wang et al., 2026
dorsal fin lepidotrichium increased length, abnormal stc2ami614/mi614 standard conditions Figure 3 with image from Wang et al., 2026
whole organism length, ameliorated stc2ami614/mi614 chemical treatment by environment: BMS-754807 Figure 4 with image from Wang et al., 2026
whole organism decreased length, abnormal stc2ami614/mi614 hypoxia, chemical treatment by environment: zinc dichloride Figure 5 with image from Wang et al., 2026
whole organism length, ameliorated stc2ami614/mi614 chemical treatment by environment: wortmannin Figure 4 with image from Wang et al., 2026
whole organism increased weight, abnormal stc2ami614/mi614 standard conditions Figure 3 with image from Wang et al., 2026
whole organism length, ameliorated stc2ami614/mi614 hypoxia Figure 5 with image from Wang et al., 2026
somite increased amount, abnormal stc2ami614/mi614 standard conditions Figure 3 with image from Wang et al., 2026
whole organism length, ameliorated stc2ami614/mi614 chemical treatment by environment: zinc dichloride Figure 4 with image from Wang et al., 2026
head decreased angle to trunk, abnormal stc2ami614/mi614 hypoxia, chemical treatment by environment: zinc dichloride Figure 5 with image from Wang et al., 2026
head angle trunk, ameliorated stc2ami614/mi614 hypoxia Figure 5 with image from Wang et al., 2026
pectoral fin lepidotrichium increased length, abnormal stc2ami614/mi614 standard conditions Figure 3 with image from Wang et al., 2026
head increased angle to trunk, abnormal stc2ami614/mi614 standard conditions Figure 3 with image from Wang et al., 2026
whole organism increased length, abnormal stc2ami615/mi615 standard conditions Figure 3 with image from Wang et al., 2026
whole organism viability, ameliorated stc2ami615/mi615 hypoxia, chemical treatment by environment: zinc dichloride Figure 5 with image from Wang et al., 2026
somite increased amount, abnormal stc2ami615/mi615 standard conditions Figure 3 with image from Wang et al., 2026
head increased angle to trunk, abnormal stc2ami615/mi615 standard conditions Figure 3 with image from Wang et al., 2026
whole organism viability, exacerbated stc2ami615/mi615 hypoxia Figure 5 with image from Wang et al., 2026
whole organism viability, exacerbated stc2ami614/+ hypoxia Figure 5 with image from Wang et al., 2026
Citations