CRISPR

CRISPR5-lrrc8aa

ID
ZDB-CRISPR-260212-1
Name
CRISPR5-lrrc8aa
Previous Names
None
Target
Sequence
5' - TGAGGTGGTGTTTGCAAGTCTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
twu0421 lrrc8aa
Expression
Gene expression in Wild Types + CRISPR5-lrrc8aa
No data available
Phenotype
Phenotype resulting from CRISPR5-lrrc8aa
No data available
Phenotype of all Fish created by or utilizing CRISPR5-lrrc8aa
Phenotype Fish Conditions Figures
third ventricle decreased volume, abnormal lrrc8aatwu0421/twu0421 + MO1-lrrc8ab + MO2-lrrc8ab (AB) standard conditions FIGURE 1 with image from Tseng et al., 2025
tectal ventricle decreased volume, abnormal lrrc8aatwu0421/twu0421 + MO1-lrrc8ab + MO2-lrrc8ab (AB) standard conditions FIGURE 1 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
posterior cardinal vein decreased diameter, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
heart contraction increased frequency, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal longitudinal anastomotic vessel blood vessel development delayed, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
intersegmental vessel blood vessel development delayed, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
common cardinal vein blood vessel development delayed, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
common cardinal vein decreased length, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism myh6 expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
posterior cardinal vein decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
whole organism amotl2a expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
posterior cardinal vein decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
intersegmental vessel blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
whole organism prox1a expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism vegfc expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
common cardinal vein mrc1a expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism flt4 expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
intersegmental vessel blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
whole organism prox1a expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism egfl7 expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism myh6 expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism myh7 expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
heart contraction decreased frequency, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
heart contraction decreased frequency, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
whole organism cldn5b expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
blood circulation decreased occurrence, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
whole organism klf2a expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis disrupted, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
heart contraction increased frequency, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ + CRISPR1-cysltr1 + CRISPR2-cysltr1 (AB) standard conditions FIGURE 7 with image from Tseng et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.