CRISPR

CRISPR1-csde1

ID
ZDB-CRISPR-260126-4
Name
CRISPR1-csde1
Previous Names
None
Target
Sequence
5' - GGGAGTGGTTTGTGCTACCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ioh3 csde1
Expression
Gene expression in Wild Types + CRISPR1-csde1
No data available
Phenotype
Phenotype resulting from CRISPR1-csde1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-csde1
Phenotype Fish Conditions Figures
whole organism rag1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with imageFig. 2. with imageFig. 6. with image from Li et al., 2023
whole organism runx1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
nucleate erythrocyte hbae1.1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
thymus lymphoid progenitor cell rag1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
whole organism myb expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
whole organism hbae1.1 expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with imageFig. 6. with image from Li et al., 2023
caudal hematopoietic tissue hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
thymus lymphoid progenitor cell rag1 expression decreased distribution, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
hematopoietic multipotent progenitor cell gfi1aa expression decreased amount, abnormal csde1ioh3/ioh3 standard conditions Fig. 1. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal csde1ioh3/ioh3; ioz1Tg/ioz1Tg; s896Tg/s896Tg standard conditions Fig. 1. with image from Li et al., 2023
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal csde1ioh3/ioh3; ioz1Tg/ioz1Tg; s896Tg/s896Tg standard conditions Fig. 1. with image from Li et al., 2023
Wnt signaling pathway decreased occurrence, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell differentiation decreased occurrence, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
stem cell development decreased occurrence, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
cell fate specification decreased occurrence, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell tcf7l2 expression decreased amount, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
cell population proliferation decreased occurrence, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell tcf3a expression decreased amount, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell vim expression decreased amount, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell axin2 expression decreased amount, abnormal csde1ioh3/ioh3; s843Tg/s843Tg standard conditions Fig. 3. with image from Li et al., 2023
Citations