CRISPR

CRISPR2-tafazzin

ID
ZDB-CRISPR-250911-1
Name
CRISPR2-tafazzin
Previous Names
None
Target
Sequence
5' - TCCACAACTGCCGGAACTTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
lri113 tafazzin
Expression
Gene expression in Wild Types + CRISPR2-tafazzin
No data available
Phenotype
Phenotype resulting from CRISPR2-tafazzin
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tafazzin
Phenotype Fish Conditions Figures
head kidney il6 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism hadhab expression increased amount, abnormal tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
whole organism fatty acid 20:0 increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
head kidney atf4b expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism lclat1 expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
whole organism cholesterol decreased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
neutrophil decreased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 1 with image,  text only from Oyarbide et al., 2025
heart lclat1 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
aerobic respiration decreased occurrence, abnormal tafazzinlri113/lri113 standard conditions Fig. 4 with image from Oyarbide et al., 2025
whole organism phosphatidylcholine increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
whole organism O-tetradecanoyl-L-carnitine increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
whole organism 3-methylglutaconic acid increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
whole organism monolysocardiolipin(2-) increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
head kidney cdkn1a expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
head kidney cebpd expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism cdkn1a expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 2 with image from Oyarbide et al., 2025
head kidney myeloid cell increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 6 with image from Oyarbide et al., 2025
whole organism tafazzin expression decreased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 1 with image from Oyarbide et al., 2025
kidney neutrophil increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 6 with image from Oyarbide et al., 2025
heart hadhab expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
head kidney cebpa expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
head kidney baxa expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism atf4b expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
head kidney bbc3 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism ddit3 expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
heart tafazzin expression decreased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
head kidney ddit3 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism atf6 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 2 with image from Oyarbide et al., 2025
heart il6 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
head kidney tafazzin expression decreased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism hadhaa expression increased amount, abnormal tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
whole organism ATP decreased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
whole organism O-octadecanoyl-L-carnitine increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
heart tp53 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism baxa expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
head kidney atf6 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism fatty acid 20:1 increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
whole organism atf4a expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
whole organism tafazzin expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
whole organism xbp1 expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
heart monolysocardiolipin(2-) increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
head kidney hadhab expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
heart hadhaa expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism lclat1 expression increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 2 with image from Oyarbide et al., 2025
whole organism hspa5 expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
head kidney monolysocardiolipin(2-) increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 7 with image from Oyarbide et al., 2025
whole organism cdkn1a expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
whole organism lysophosphatidylcholine increased amount, abnormal tafazzinlri113/lri113 standard conditions Fig. 3 with image from Oyarbide et al., 2025
whole organism tp53 expression amount, ameliorated tafazzinlri113/lri113 chemical treatment by environment: rotenone Fig. 2 with image from Oyarbide et al., 2025
Citations