CRISPR

CRISPR1-plk4

ID

ZDB-CRISPR-250808-7

Name

CRISPR1-plk4

Previous Names

None

Target

plk4 (1)

Sequence

5' - GGGATTGGTGCCATACGACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf4240	plk4

Expression

Gene expression in Wild Types + CRISPR1-plk4

No data available

Phenotype

Phenotype resulting from CRISPR1-plk4

No data available

Phenotype of all Fish created by or utilizing CRISPR1-plk4

Phenotype	Fish	Conditions	Figures
head opaque, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 1 from Mu et al., 2024
whole organism urp2 expression decreased amount, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
cell mitotic cell cycle process arrested, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
neuromast urp2 expression decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
olfactory pit cilium ab1-tub-glut labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
cell mitotic spindle increased amount, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
olfactory pit centrosome ab1-tubg1 labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
cell mitotic spindle ab1-tuba labeling spatial pattern, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
pronephric duct cilium decreased amount, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
post-vent region curved, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 1, Fig. 3 from Mu et al., 2024
eye decreased size, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 1 from Mu et al., 2024
cell mitotic spindle morphology, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
pronephric duct centrosome ab1-tubg1 labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
pericardium edematous, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 1 from Mu et al., 2024
cell microtubule cytoskeleton organization involved in mitosis process quality, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
pronephric duct cilium ab1-tuba labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
whole organism tp53 expression increased amount, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
neuromast hair cell centrosome ab1-tubg1 labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
whole organism plk4 expression decreased amount, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 1 from Mu et al., 2024
integument wrinkled, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 1 from Mu et al., 2024
whole organism urp1 expression decreased amount, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
whole organism apoptotic process increased process quality, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 2 from Mu et al., 2024
neuromast urp1 expression decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
neuromast hair cell cilium ab1-tub-glut labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
pronephric duct cilium decreased length, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024
pronephric duct cilium ab1-tub-glut labeling decreased distribution, abnormal	plk4^{zf4240/zf4240} (TU)	standard conditions	Fig. 3 from Mu et al., 2024

Citations