CRISPR

CRISPR2-pikfyve

ID
ZDB-CRISPR-250115-6
Name
CRISPR2-pikfyve
Previous Names
None
Target
Sequence
5' - GGGAGTTCTTGTAGCCGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sca1 pikfyve
sca2 pikfyve
Expression
Gene expression in Wild Types + CRISPR2-pikfyve
No data available
Phenotype
Phenotype resulting from CRISPR2-pikfyve
No data available
Phenotype of all Fish created by or utilizing CRISPR2-pikfyve
Phenotype Fish Conditions Figures
macrophage increased size, abnormal pikfyvesca1/sca1 standard conditions Figure 5 with image from Xia et al., 2024
TOR signaling normal occurrence, ameliorated pikfyvesca1/sca1 chemical treatment by environment: sirolimus Figure 4 with image from Xia et al., 2024
caudal hematopoietic tissue vacuole present, abnormal pikfyvesca1/sca1 standard conditions Figure 1 with image from Xia et al., 2024
TOR signaling increased occurrence, abnormal pikfyvesca1/sca1 standard conditions Figure 4 with image from Xia et al., 2024
esophagus cell death increased occurrence, abnormal pikfyvesca1/sca1 standard conditions Figure 1 with image from Xia et al., 2024
whole organism dead, abnormal pikfyvesca1/sca1 standard conditions Figure 1 with image from Xia et al., 2024
intestine cell death increased occurrence, abnormal pikfyvesca1/sca1 standard conditions Figure 1 with image from Xia et al., 2024
pharynx cell death increased occurrence, abnormal pikfyvesca1/sca1 standard conditions Figure 1 with image from Xia et al., 2024
macrophage size, ameliorated pikfyvesca1/sca1 chemical treatment by environment: sirolimus Figure 5 with image from Xia et al., 2024
brain cell death increased occurrence, abnormal pikfyvesca1/sca1 standard conditions Figure 1 with image from Xia et al., 2024
macrophage increased size, abnormal pikfyvesca1/sca1; ihb20Tg standard conditions Figure 1 with image from Xia et al., 2024
whole organism dead, ameliorated pikfyvesca1/sca1; ihb20Tg chemical treatment by environment: sirolimus Figure 3 with image from Xia et al., 2024
whole organism dead, ameliorated pikfyvesca1/sca1; ihb20Tg chemical treatment by environment: torin 1 Figure 3 with image from Xia et al., 2024
macrophage size, ameliorated pikfyvesca1/sca1; ihb20Tg chemical treatment by environment: torin 1 Figure 3 with image from Xia et al., 2024
macrophage size, ameliorated pikfyvesca1/sca1; ihb20Tg chemical treatment by environment: sirolimus Figure 3 with image from Xia et al., 2024
macrophage discoid, abnormal pikfyvesca1/sca1; ihb20Tg standard conditions Figure 1 with image from Xia et al., 2024
macrophage lysosome fused with macrophage lysosome, abnormal pikfyvesca1/sca1; ihb20Tg standard conditions Figure 2 with image from Xia et al., 2024
macrophage lysosome increased size, abnormal pikfyvesca1/sca1; ihb20Tg standard conditions Figure 2 with image from Xia et al., 2024
caudal hematopoietic tissue macrophage decreased cellular motility, abnormal pikfyvesca1/sca1; ihb20Tg standard conditions Figure 2 with image from Xia et al., 2024
whole organism dead, abnormal pikfyvesca1/sca1; ihb20Tg standard conditions Figure 3 with image from Xia et al., 2024
macrophage size, ameliorated pikfyvesca1/sca1; ihb20Tg + CRISPR5-mtor standard conditions Figure 3 with image from Xia et al., 2024
Citations