CRISPR

CRISPR1-dhx38

ID
ZDB-CRISPR-240827-1
Name
CRISPR1-dhx38
Previous Names
None
Target
Sequence
5' - GCCTTCTAGCCGGTGCAGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu20 dhx38
zf4116 dhx38
zko2862A dhx38
zko2862B dhx38
Expression
Gene expression in Wild Types + CRISPR1-dhx38
No data available
Phenotype
Phenotype resulting from CRISPR1-dhx38
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dhx38
Phenotype Fish Conditions Figures
whole organism cdkn1a expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
whole organism masp1 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
semicircular canal dacha expression absent, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
otolith otomp expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
inner ear development disrupted, abnormal dhx38hzu20/hzu20 standard conditions Figure 1 with imageFigure 2 with image from Ren et al., 2024
whole organism bbc3 expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
whole organism spns2 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
inner ear apoptotic process increased occurrence, ameliorated dhx38hzu20/hzu20 chemical treatment by environment: p53 inhibitor Figure 3 with image from Ren et al., 2024
whole organism casp8 expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
whole organism bcl2a expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
inner ear smc5 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
inner ear eme1 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
whole organism col11a2 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
inner ear nuclear chromosome damaged, abnormal dhx38hzu20/hzu20 standard conditions Figure 4 with image from Ren et al., 2024
inner ear slx4 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
otolith otomp expression decreased distribution, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
otic vesicle protrusion absent, ameliorated dhx38hzu20/hzu20 chemical treatment by environment: p53 inhibitor Figure 3 with image from Ren et al., 2024
whole organism gadd45ba expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
inner ear rad17 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
whole organism ret expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
inner ear rad9a expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
inner ear tonsl expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
inner ear foxj1b expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
otolith stm expression decreased distribution, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
inner ear foxm1 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
whole organism cep290 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
otolith stm expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
otic vesicle protrusion absent, abnormal dhx38hzu20/hzu20 standard conditions Figure 1 with imageFigure 3 with image from Ren et al., 2024
whole organism smad5 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
inner ear blm expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
inner ear mRNA splicing, via endonucleolytic cleavage and ligation disrupted, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with imageFigure 6 with image from Ren et al., 2024
semicircular canal bmp4 expression absent, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
whole organism pax2a expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 6 with image from Ren et al., 2024
inner ear apoptotic process increased occurrence, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
whole organism tp53 expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
inner ear fanci expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
saccule cahz expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
semicircular canal ncs1a expression absent, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
macula utricle cahz expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 2 with image from Ren et al., 2024
inner ear ints7 expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
otic vesicle decreased size, abnormal dhx38hzu20/hzu20 standard conditions Figure 1 with imageFigure 3 with image from Ren et al., 2024
otolith decreased size, abnormal dhx38hzu20/hzu20 standard conditions Figure 1 with image from Ren et al., 2024
otic vesicle size, ameliorated dhx38hzu20/hzu20 chemical treatment by environment: p53 inhibitor Figure 3 with image from Ren et al., 2024
whole organism mdm2 expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
whole organism baxa expression increased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 3 with image from Ren et al., 2024
inner ear mms22l expression decreased amount, abnormal dhx38hzu20/hzu20 standard conditions Figure 5 with image from Ren et al., 2024
Citations