CRISPR

CRISPR1-gnav1

ID

ZDB-CRISPR-240809-1

Name

CRISPR1-gnav1

Previous Names

None

Target

gnav1 (1)

Sequence

5' - GGGCTCAGAGGTGACAACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uk10	gnav1

Expression

Gene expression in Wild Types + CRISPR1-gnav1

No data available

Phenotype

Phenotype resulting from CRISPR1-gnav1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gnav1

Phenotype	Fish	Conditions	Figures
whole organism calcium(2+) decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
vertebra bone mineralization decreased process quality, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. S2 from Abu Obaid et al., 2024
ceratohyal cartilage mislocalised ventrally, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 4 from Abu Obaid et al., 2024
kidney atp1a1a.5 expression increased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
ventral mandibular arch deformed, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 4 from Abu Obaid et al., 2024
whole organism increased fragility, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	text only from Abu Obaid et al., 2024
whole organism gnav1 expression increased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 2 from Abu Obaid et al., 2024
ceratohyal cartilage increased width, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 4 from Abu Obaid et al., 2024
whole organism potassium(1+) decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
bone mineralization decreased process quality, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 4 from Abu Obaid et al., 2024
inorganic ion homeostasis process quality, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
whole organism biomineral tissue development decreased process quality, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. S2 from Abu Obaid et al., 2024
ceratohyal cartilage decreased length, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 4 from Abu Obaid et al., 2024
hatching premature, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 3 from Abu Obaid et al., 2024
kidney slc12a3 expression increased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
whole organism slc8a1b expression decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
whole organism atp1a1a.5 expression decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
hatching increased rate, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 3 from Abu Obaid et al., 2024
kidney slc8a1b expression increased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
whole organism magnesium(2+) decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024
oocyte fertilization decreased rate, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 3 from Abu Obaid et al., 2024
whole organism bone mineralization decreased process quality, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. S2 from Abu Obaid et al., 2024
chorion decreased stability, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	text only from Abu Obaid et al., 2024
whole organism gnav1 expression decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 2 from Abu Obaid et al., 2024
kidney slc26a4 expression decreased amount, abnormal	gnav1^uk10/uk10 (AB/TU)	standard conditions	Fig. 5 from Abu Obaid et al., 2024

Citations