CRISPR

CRISPR1-pex5

ID

ZDB-CRISPR-240412-1

Name

CRISPR1-pex5

Previous Names

None

Target

pex5 (1)

Sequence

5' - AATCCCCTCATGAAACTGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wk5	pex5

Expression

Gene expression in Wild Types + CRISPR1-pex5

No data available

Phenotype

Phenotype resulting from CRISPR1-pex5

No data available

Phenotype of all Fish created by or utilizing CRISPR1-pex5

Phenotype	Fish	Conditions	Figures
swim bladder uninflated, abnormal	pex5^wk5/wk5	fasting	Fig. 2 from Bhandari et al., 2023
liver lipid increased amount, abnormal	pex5^wk5/wk5	standard conditions	Fig. 1 from Bhandari et al., 2023
liver reactive oxygen species amount, ameliorated	pex5^wk5/wk5	chemical treatment by environment: N-acetyl-L-cysteine, fasting	Fig. 4 from Bhandari et al., 2023
whole organism dead, abnormal	pex5^wk5/wk5	standard conditions	Fig. 1 from Bhandari et al., 2023
whole organism decreased life span, exacerbated	pex5^wk5/wk5	fasting	Fig. 2 from Bhandari et al., 2023
whole organism decreased life span, abnormal	pex5^wk5/wk5	standard conditions	Fig. 1 from Bhandari et al., 2023
liver hypotrophic, abnormal	pex5^wk5/wk5	fasting	Fig. 2 from Bhandari et al., 2023
liver apoptotic process occurrence, ameliorated	pex5^wk5/wk5	chemical treatment by environment: N-acetyl-L-cysteine, fasting	Fig. 4 from Bhandari et al., 2023
liver apoptotic process increased occurrence, abnormal	pex5^wk5/wk5	fasting	Fig. 4 from Bhandari et al., 2023
liver reactive oxygen species increased amount, abnormal	pex5^wk5/wk5	fasting	Fig. 4 from Bhandari et al., 2023
pleuroperitoneal cavity edematous, abnormal	pex5^wk5/wk5	fasting	Fig. 2 from Bhandari et al., 2023
nervous system myelination decreased occurrence, abnormal	pex5^wk5/wk5; ck1Tg	standard conditions	Fig. 1 from Bhandari et al., 2023
liver mitochondrion broken, abnormal	pex5^wk5/wk5; cms1Tg	fasting	Fig. 3 from Bhandari et al., 2023
liver mitochondrion morphology, abnormal	pex5^wk5/wk5; cms1Tg	fasting	Fig. 3 from Bhandari et al., 2023
liver mitochondrion morphology, abnormal	pex5^wk5/wk5; cms1Tg	standard conditions	Fig. 1 from Bhandari et al., 2023
liver mitochondrion increased amount, abnormal	pex5^wk5/wk5; cms1Tg	fasting	Fig. 3 from Bhandari et al., 2023
liver mitochondrion size, abnormal	pex5^wk5/wk5; cms1Tg	standard conditions	Fig. 1 from Bhandari et al., 2023
hepatocyte peroxisome decreased amount, abnormal	pex5^wk5/wk5; wk2Tg	fasting	Fig. 2 from Bhandari et al., 2023
hepatocyte peroxisome RFP expression spatial pattern, abnormal	pex5^wk5/wk5; wk2Tg	standard conditions	Fig. 1 from Bhandari et al., 2023
liver peroxisome decreased amount, abnormal	pex5^wk5/wk5; wk2Tg	standard conditions	Fig. 1 from Bhandari et al., 2023

Citations