CRISPR

CRISPR1-smc5

ID

ZDB-CRISPR-240301-1

Name

CRISPR1-smc5

Previous Names

None

Target

smc5 (1)

Sequence

5' - GGCACGTAAAGAGCTGGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
rj51	smc5

Expression

Gene expression in Wild Types + CRISPR1-smc5

No data available

Phenotype

Phenotype resulting from CRISPR1-smc5

No data available

Phenotype of all Fish created by or utilizing CRISPR1-smc5

Phenotype	Fish	Conditions	Figures
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
post-vent region apoptotic process increased process quality, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
head apoptotic process increased process quality, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
whole organism gadd45aa expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism ccng1 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism pcna expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
ceratohyal cartilage decreased length, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
whole organism bbc3 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism ccna1 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
whole organism tdp1 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism cdkn1a expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism h2ax expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism tp53 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism semi-viable, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
whole organism ccna1 expression decreased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism length, ameliorated	smc5^rj51/rj51	chemical treatment by environment: pifithrin-?	FIGURE 4 from Zhu et al., 2023
whole organism smc5 expression decreased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism mdm2 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
palatoquadrate cartilage decreased length, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
whole organism decreased length, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 , FIGURE 4 from Zhu et al., 2023
whole organism ccnb2 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism length, ameliorated	smc5^rj51/rj51	chemical treatment by environment: carbaryl	FIGURE 4 from Zhu et al., 2023
head decreased length, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
head increased width, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
blood glucose increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 3 from Zhu et al., 2023
whole organism casp8 expression increased amount, abnormal	smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023
whole organism length, ameliorated	smc5^rj51/rj51 + MO11-tp53	control	FIGURE 4 from Zhu et al., 2023
whole organism length, ameliorated	tp53^zdf1/zdf1; smc5^rj51/rj51	standard conditions	FIGURE 4 from Zhu et al., 2023

Citations