CRISPR

CRISPR2-slc30a1a

ID

ZDB-CRISPR-240104-2

Name

CRISPR2-slc30a1a

Previous Names

None

Target

slc30a1a (1)

Sequence

5' - GCCCTGGGTTGTGATCGGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end. This CRISPR targets slc30a1a as well as the end of nek2.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zju32	slc30a1a

Expression

Gene expression in Wild Types + CRISPR2-slc30a1a

No data available

Phenotype

Phenotype resulting from CRISPR2-slc30a1a

No data available

Phenotype of all Fish created by or utilizing CRISPR2-slc30a1a

Phenotype	Fish	Conditions	Figures
whole organism kita expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
trunk melanoblast dct expression decreased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Fig. 4 from Xia et al., 2022
trunk melanoblast dct expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
eye melanin biosynthetic process decreased occurrence, ameliorated	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	chemical treatment by environment: N-phenylthiourea	Fig. 1 from Xia et al., 2022
integument melanin biosynthetic process decreased occurrence, ameliorated	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	chemical treatment by environment: N-phenylthiourea	Fig. 1 from Xia et al., 2022
eye melanoblast dct expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 4 from Xia et al., 2022
eye melanoblast dct expression increased distribution, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
trunk melanoblast mitfa expression spatial pattern, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 4 from Xia et al., 2022
whole organism tyr expression decreased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 4 from Xia et al., 2022
whole organism dct expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34	standard conditions	Fig. 2 from Xia et al., 2022
yolk syncytial layer melanoblast mt2 expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
head melanoblast mt2 expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
neural crest melanosome organization increased occurrence, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
whole organism mt2 expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
neural crest response to zinc ion increased occurrence, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 4 from Xia et al., 2022
whole organism kita expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
trunk melanoblast dct expression decreased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Fig. 4 from Xia et al., 2022
trunk melanoblast dct expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
eye melanin biosynthetic process decreased occurrence, ameliorated	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	chemical treatment by environment: N-phenylthiourea	Fig. 1 from Xia et al., 2022
integument melanin biosynthetic process decreased occurrence, ameliorated	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	chemical treatment by environment: N-phenylthiourea	Fig. 1 from Xia et al., 2022
eye melanoblast dct expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
eye melanoblast dct expression increased distribution, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 4 from Xia et al., 2022
trunk melanoblast mitfa expression spatial pattern, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
whole organism tyr expression decreased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 4 from Xia et al., 2022
whole organism dct expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35	standard conditions	Fig. 2 from Xia et al., 2022
yolk syncytial layer melanoblast mt2 expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
head melanoblast mt2 expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
neural crest melanosome organization increased occurrence, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
whole organism mt2 expression increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
neural crest response to zinc ion increased occurrence, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35; el2Tg/el2Tg	standard conditions	Fig. 3 from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, exacerbated	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
trunk melanoblast dct expression amount, ameliorated	slc30a1a^zju32/zju32; slc30a1b^zju34/zju34 + MO1-mt2	chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Fig. 4 from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, exacerbated	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
trunk melanoblast dct expression amount, ameliorated	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35 + MO1-mt2	chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine	Fig. 4 from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal	slc30a1a^zju32/zju32; slc30a1b^zju35/zju35 + MO1-mt2	standard conditions	Fig. 4 from Xia et al., 2022

Citations