CRISPR

CRISPR1-slc1a2b

ID
ZDB-CRISPR-230804-6
Name
CRISPR1-slc1a2b
Previous Names
None
Target
Sequence
5' - GGTCTGGATGCCAAGTCGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zh7 slc1a2b
Expression
Gene expression in Wild Types + CRISPR1-slc1a2b
No data available
Phenotype
Phenotype resulting from CRISPR1-slc1a2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-slc1a2b
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal slc1a2bzh7/zh7 standard conditions Fig. 2 with image from Hotz et al., 2021
swim bladder uninflated, abnormal slc1a2bzh7/zh7 standard conditions Fig. 2 with image from Hotz et al., 2021
swimming decreased process quality, abnormal slc1a2bzh7/zh7 standard conditions Fig. 3 with image from Hotz et al., 2021
whole organism decreased life span, abnormal slc1a2bzh7/zh7 standard conditions Fig. 2 with image from Hotz et al., 2021
swimming irregular duration, abnormal slc1a2bzh7/zh7 standard conditions Fig. 3 with image from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal slc1a2bzh7/zh7 standard conditions Fig. 2 with imageFig. 3 with image from Hotz et al., 2021
brain gad1b expression increased amount, abnormal slc1a2bzh7/zh7 standard conditions Fig. 5 with image from Hotz et al., 2021
brain slc1a3b expression increased amount, abnormal slc1a2bzh7/zh7 standard conditions Fig. 5 with image from Hotz et al., 2021
heart edematous, abnormal slc1a2bzh7/zh7 standard conditions Fig. 2 with image from Hotz et al., 2021
brain neuronal action potential increased process quality, abnormal slc1a2bzh7/+; jf4Tg visible light Fig. 2 with image from Hotz et al., 2021
telencephalon glutamate(1-) increased amount, abnormal slc1a2bzh7/zh7; cu3313Tg standard conditions Fig. 3 with image from Hotz et al., 2021
telencephalon obsolete extracellular space cpEGFP expression increased amount, abnormal slc1a2bzh7/zh7; cu3313Tg standard conditions Fig. 3 with image from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal slc1a2bzh7/zh7; cu3313Tg standard conditions Fig. 3 with image from Hotz et al., 2021
telencephalon neuronal action potential increased process quality, abnormal slc1a2bzh7/zh7; cu3313Tg standard conditions Fig. 3 with image from Hotz et al., 2021
brain GCaMP expression increased amount, abnormal slc1a2bzh7/zh7; jf4Tg visible light Fig. 2 with image from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal slc1a2bzh7/zh7; jf4Tg visible light Fig. 2 with image from Hotz et al., 2021
brain neuronal action potential increased process quality, exacerbated slc1a2bzh7/zh7; jf4Tg visible light Fig. 2 with image from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal slc1a2bzh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg standard conditions Fig. 5 with image from Hotz et al., 2021
astrocyte regulation of glutamate uptake involved in transmission of nerve impulse decreased process quality, abnormal slc1a2bzh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg standard conditions Fig. 5 with image from Hotz et al., 2021
brain neuronal action potential occurrence, abnormal slc1a2bzh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg standard conditions Fig. 5 with image from Hotz et al., 2021
brain neuronal action potential increased spatial extent of a process, abnormal slc1a2bzh7/zh7; nkUAShspzGCaMP6s13aTg; nw7Tg standard conditions Fig. 5 with image from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal slc1a2bzh7/zh7; zf498Tg standard conditions Fig. 4 with image from Hotz et al., 2021
brain neuronal action potential occurrence, abnormal slc1a2bzh7/zh7; zf498Tg visible light Fig. 4 with image from Hotz et al., 2021
brain neuronal action potential occurrence, abnormal slc1a2bzh7/zh7; zf498Tg standard conditions Fig. 4 with image from Hotz et al., 2021
brain GCaMP expression increased amount, abnormal slc1a2bzh7/zh7; zf498Tg visible light Fig. 4 with image from Hotz et al., 2021
brain regulation of neuronal action potential decreased process quality, abnormal slc1a2bzh7/zh7; zf498Tg visible light Fig. 4 with image from Hotz et al., 2021
brain neuronal action potential increased spatial extent of a process, abnormal slc1a2bzh7/zh7; zf498Tg standard conditions Fig. 4 with image from Hotz et al., 2021
brain neuronal action potential increased spatial extent of a process, abnormal slc1a2bzh7/zh7; zf498Tg visible light Fig. 4 with image from Hotz et al., 2021
Citations