CRISPR

CRISPR1-myrf

ID
ZDB-CRISPR-230728-2
Name
CRISPR1-myrf
Previous Names
None
Target
Sequence
5' - CATTGACACCAGTATCCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ue70 myrf
Expression
Gene expression in Wild Types + CRISPR1-myrf
No data available
Phenotype
Phenotype resulting from CRISPR1-myrf
No data available
Phenotype of all Fish created by or utilizing CRISPR1-myrf
Phenotype Fish Conditions Figures
neuron myelin sheath decreased thickness, abnormal myrfue70/ue70 (TL) standard conditions Figure 2. with image from Madden et al., 2021
swimming behavior decreased process quality, abnormal myrfue70/ue70 (TL) standard conditions Figure 4. with image from Madden et al., 2021
Mauthner neuron action potential propagation decreased process quality, abnormal myrfue70/ue70 (TL) standard conditions Figure 5. with image from Madden et al., 2021
Mauthner neuron myelin sheath decreased thickness, abnormal myrfue70/ue70 (TL) standard conditions Figure 2. with image from Madden et al., 2021
spinal cord myelination decreased process quality, abnormal myrfue70/ue70 (TL) standard conditions Figure 1. with imageFigure 2. with image from Madden et al., 2021
auditory behavior decreased process quality, abnormal myrfue70/ue70 (TL) standard conditions Figure 4. with image from Madden et al., 2021
whole organism female sterile, abnormal myrfue70/ue70 (TL) standard conditions text only from Madden et al., 2021
female organism gonad absence of anatomical entity, abnormal myrfue70/ue70 (TL) standard conditions text only from Madden et al., 2021
brain mbpa expression decreased amount, abnormal myrfue70/ue70 (TL) standard conditions Figure 1. with image from Madden et al., 2021
spinal cord myelin accumulating cell EGFP expression decreased distribution, abnormal myrfue70/ue70; ue2Tg (TL) standard conditions Figure 1. with image from Madden et al., 2021
spinal cord myelination decreased process quality, abnormal myrfue70/ue70; ue2Tg (TL) standard conditions Figure 1. with image from Madden et al., 2021
spinal cord oligodendrocyte GFP expression decreased amount, abnormal myrfue70/ue70; zf3078Tg (TL) standard conditions Figure 3. with image from Madden et al., 2021
oligodendrocyte myelin sheath decreased amount, abnormal myrfue70/ue70; zf3078Tg (TL) standard conditions Figure 3. with image from Madden et al., 2021
spinal cord oligodendrocyte decreased amount, abnormal myrfue70/ue70; zf3078Tg (TL) standard conditions Figure 3. with image from Madden et al., 2021
oligodendrocyte myelin sheath morphology, abnormal myrfue70/ue70; zf3078Tg (TL) standard conditions Figure 3. with image from Madden et al., 2021
oligodendrocyte myelin sheath retracted, abnormal myrfue70/ue70; zf3078Tg (TL) standard conditions Figure 3. with image from Madden et al., 2021
oligodendrocyte myelin sheath decreased length, abnormal myrfue70/ue70; zf3078Tg (TL) standard conditions Figure 3. with image from Madden et al., 2021
spinal cord oligodendrocyte amount, ameliorated fbxw7vo86/vo86; myrfue70/+ standard conditions Fig. 7 with image from Collins et al., 2025
Citations