CRISPR

CRISPR2-smc2

ID

ZDB-CRISPR-230525-1

Name

CRISPR2-smc2

Previous Names

None

Target

smc2 (1)

Sequence

5' - ATCACTGGACTGAACGGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3797	smc2
zf3798	smc2

Expression

Gene expression in Wild Types + CRISPR2-smc2

No data available

Phenotype

Phenotype resulting from CRISPR2-smc2

No data available

Phenotype of all Fish created by or utilizing CRISPR2-smc2

Phenotype	Fish	Conditions	Figures
whole organism mdm2 expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
endocrine pancreas ins expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 3 from Li et al., 2021
brain necrotic, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 2 from Li et al., 2021
head decreased size, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 2 from Li et al., 2021
eye decreased size, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 2 from Li et al., 2021
whole organism smc2 expression decreased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 2 from Li et al., 2021
liver gata4 expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 4 from Li et al., 2021
liver foxa3 expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 4 from Li et al., 2021
spinal cord necrotic, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 2 from Li et al., 2021
liver decreased size, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 3 from Li et al., 2021
whole organism casp8 expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
whole organism baxa expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
whole organism dead, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	text only from Li et al., 2021
whole organism gadd45aa expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
intestine fabp2 expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 3 from Li et al., 2021
liver prox1a expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 4 from Li et al., 2021
liver hhex expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 4 from Li et al., 2021
exocrine pancreas prss1 expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 3 from Li et al., 2021
whole organism tp53 expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
liver foxa1 expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 4 from Li et al., 2021
whole organism bbc3 expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
head necrotic, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 2 from Li et al., 2021
liver fabp10a expression decreased distribution, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 3 from Li et al., 2021
whole organism cdkn1a expression increased amount, abnormal	smc2^{zf3797/zf3797} (AB)	standard conditions	Figure 5 from Li et al., 2021
whole organism smc2 expression decreased amount, abnormal	smc2^{zf3798/zf3798} (AB)	standard conditions	Figure 2 from Li et al., 2021
whole organism dead, abnormal	smc2^{zf3798/zf3798} (AB)	standard conditions	text only from Li et al., 2021
whole organism atr expression increased amount, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 7 from Li et al., 2021
liver apoptotic process increased process quality, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 5 , Figure 6 from Li et al., 2021
hepatocyte nucleus increased size, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 7 from Li et al., 2021
liver cell population proliferation decreased process quality, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 5 from Li et al., 2021
liver decreased size, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 3 from Li et al., 2021
hepatocyte DNA double-strand break processing increased process quality, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 7 from Li et al., 2021
liver DsRed expression decreased distribution, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 3 , Figure 5 , Figure 6 , Figure 7 from Li et al., 2021
whole organism atm expression increased amount, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 7 from Li et al., 2021
liver fabp10a expression decreased distribution, abnormal	smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 6 from Li et al., 2021
liver apoptotic process process quality, ameliorated	tp53^zdf1/zdf1; smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 6 from Li et al., 2021
liver DsRed expression spatial pattern, ameliorated	tp53^zdf1/zdf1; smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 6 from Li et al., 2021
liver fabp10a expression spatial pattern, ameliorated	tp53^zdf1/zdf1; smc2^{zf3797/zf3797}; gz15Tg (AB)	standard conditions	Figure 6 from Li et al., 2021

Citations