CRISPR

CRISPR4-jag2b

ID
ZDB-CRISPR-230421-2
Name
CRISPR4-jag2b
Previous Names
None
Target
Sequence
5' - GGCTTGCGCACACGGGCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ion28h jag2b
Expression
Gene expression in Wild Types + CRISPR4-jag2b
No data available
Phenotype
Phenotype resulting from CRISPR4-jag2b
No data available
Phenotype of all Fish created by or utilizing CRISPR4-jag2b
Phenotype Fish Conditions Figures
somite dld expression decreased amount, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 4 with image from Wada et al., 2022
hematopoietic stem cell differentiation decreased process quality, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 2 with image from Wada et al., 2022
somite efna1b expression decreased amount, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 5 with image from Wada et al., 2022
somite wnt16 expression decreased amount, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 4 with image from Wada et al., 2022
dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 2 with image from Wada et al., 2022
dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 2 with image from Wada et al., 2022
somite dlc expression decreased amount, abnormal AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 4 with image from Wada et al., 2022
ventral wall of dorsal aorta hematopoietic stem cell differentiation decreased process quality, abnormal hzm7Et + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal hzm7Et + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal hzm7Et + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
somite Notch signaling pathway decreased process quality, abnormal um14Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
somite EGFP expression decreased amount, abnormal um14Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal ncv7Tg; nkgSAIzGFFM1770AGt; nkuasgfp1aTg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 2 with image from Wada et al., 2022
ventral wall of dorsal aorta hematopoietic stem cell differentiation decreased process quality, abnormal ncv7Tg; nkgSAIzGFFM1770AGt; nkuasgfp1aTg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 2 with image from Wada et al., 2022
ventral wall of dorsal aorta hematopoietic stem cell differentiation process quality, ameliorated hzm7Et; kca3Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
dorsal aorta has number of hematopoietic stem cell, ameliorated hzm7Et; kca3Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated hzm7Et; kca3Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b standard conditions Fig. 3 with image from Wada et al., 2022
Citations