CRISPR

CRISPR2-il10

ID
ZDB-CRISPR-230213-17
Name
CRISPR2-il10
Previous Names
None
Target
Sequence
5' - GGGCTTTCCTTTAAGACTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uu1751 il10
Expression
Gene expression in Wild Types + CRISPR2-il10
No data available
Phenotype
Phenotype resulting from CRISPR2-il10
No data available
Phenotype of all Fish created by or utilizing CRISPR2-il10
Phenotype Fish Conditions Figures
whole organism il17a/f3 expression increased amount, abnormal il10uu1751/uu1751 standard conditions Fig. 2 with imageFig. 4 with image from Morales et al., 2022
intestine her9 expression decreased amount, abnormal il10uu1751/uu1751 standard conditions Fig. 5 with image from Morales et al., 2022
whole organism il17a/f3 expression amount, ameliorated il10uu1751/uu1751 chemical treatment by environment: sodium hypochlorite, chemical treatment by environment: ampicillin, chemical treatment by environment: kanamycin Fig. 4 with image from Morales et al., 2022
whole organism ifng1 expression increased amount, abnormal il10uu1751/uu1751 standard conditions Fig. 2 with imageFig. 4 with image from Morales et al., 2022
mid intestine regulation of intestinal epithelial cell development process quality, ameliorated il10uu1751/uu1751 chemical treatment by environment: Yhhu 3792 Fig. 5 with image from Morales et al., 2022
mid intestine has extra parts of type mid intestine goblet cell, abnormal il10uu1751/uu1751 standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with image from Morales et al., 2022
intestine Notch signaling pathway process quality, ameliorated il10uu1751/uu1751 chemical treatment by environment: Yhhu 3792 Fig. 5 with image from Morales et al., 2022
mid intestine regulation of intestinal epithelial cell development decreased process quality, abnormal il10uu1751/uu1751 standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with image from Morales et al., 2022
mid intestine has number of mid intestine goblet cell, ameliorated il10uu1751/uu1751 chemical treatment by environment: sodium hypochlorite, chemical treatment by environment: ampicillin, chemical treatment by environment: kanamycin Fig. 4 with image from Morales et al., 2022
mid intestine has number of mid intestine goblet cell, ameliorated il10uu1751/uu1751 chemical treatment by environment: Yhhu 3792 Fig. 5 with image from Morales et al., 2022
whole organism ifng1 expression amount, ameliorated il10uu1751/uu1751 chemical treatment by environment: sodium hypochlorite, chemical treatment by environment: ampicillin, chemical treatment by environment: kanamycin Fig. 4 with image from Morales et al., 2022
intestine her6 expression decreased amount, abnormal il10uu1751/uu1751 standard conditions Fig. 5 with image from Morales et al., 2022
intestine Notch signaling pathway decreased process quality, abnormal il10uu1751/uu1751 standard conditions Fig. 5 with image from Morales et al., 2022
intestine EGFP expression decreased amount, abnormal il10uu1751/uu1751; um14Tg standard conditions Fig. 5 with image from Morales et al., 2022
Citations