CRISPR

CRISPR1-myh7,myh7l

ID

ZDB-CRISPR-221207-1

Name

CRISPR1-myh7,myh7l

Previous Names

None

Targets

myh7 (1)
myh7l (1)

Sequence

5' - GAATGAGGGTGAGTTGACCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

No data available

Expression

Gene expression in Wild Types + CRISPR1-myh7,myh7l

Expressed Gene	Anatomy	Figures
myh7	cardiac ventricle pericardial cavity	Figure 4 from Hesaraki et al., 2022
myh7l	cardiac ventricle	Figure 4 from Hesaraki et al., 2022
mylk3	cardiac ventricle	Figure 4 from Hesaraki et al., 2022

Phenotype

Phenotype resulting from CRISPR1-myh7,myh7l

No data available

Phenotype of all Fish created by or utilizing CRISPR1-myh7,myh7l

Phenotype	Fish	Conditions	Figures
cardiac ventricle myh7l expression decreased amount, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
pericardium edematous, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
whole organism decreased life span, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac ventricle mylk3 expression decreased amount, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
whole organism dead, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac ventricle development disrupted, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
heart contraction disrupted, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Fig. SVideo1 from Hesaraki et al., 2022
heart blood circulation disrupted, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Fig. SVideo1 from Hesaraki et al., 2022
cardiac ventricle myh7 expression decreased amount, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
pericardial cavity myh7 expression mislocalised, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac atrium development disrupted, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac ventricle myh7 expression increased distribution, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
yolk syncytial layer edematous, abnormal	WT + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
heart tubular, abnormal	ka8Tg + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac ventricle increased thickness, abnormal	ka8Tg + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
heart looping disrupted, abnormal	ka8Tg + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
atrium increased size, abnormal	ka8Tg + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac ventricle increased size, abnormal	ka8Tg + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022
cardiac ventricle elongated, abnormal	ka8Tg + CRISPR1-myh7,myh7l	standard conditions	Figure 4 from Hesaraki et al., 2022

Citations