CRISPR

CRISPR1-asxl1

ID
ZDB-CRISPR-220825-1
Name
CRISPR1-asxl1
Previous Names
None
Target
Sequence
5' - GGGTGTGGATGTCATCAGGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sm18 asxl1
sm19 asxl1
zko3369A asxl1
Expression
Gene expression in Wild Types + CRISPR1-asxl1
No data available
Phenotype
Phenotype resulting from CRISPR1-asxl1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-asxl1
Phenotype Fish Conditions Figures
hepatocyte vacuole increased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 4 with image from Fang et al., 2021
head kidney neutrophil mpx expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
whole organism Ab4-h2a labeling decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 7 with image from Fang et al., 2021
head kidney neutrophil cebp1 expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
head kidney neutrophil decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
whole organism bmi1a expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 6 with image from Fang et al., 2021
liver fibrotic, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 4 with image from Fang et al., 2021
head kidney asxl1 expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 1 with image from Fang et al., 2021
head kidney erythroblast increased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
blood monocyte increased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 4 with image from Fang et al., 2021
head kidney neutrophil cebpa expression increased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
whole organism mpx expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 2 with image from Fang et al., 2021
neutrophil immature, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 2 with image from Fang et al., 2021
neutrophil decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 2 with image from Fang et al., 2021
liver macrophage infiltrative, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 4 with image from Fang et al., 2021
caudal hematopoietic tissue lyz expression decreased distribution, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 2 with image from Fang et al., 2021
head kidney monocyte increased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 4 with image from Fang et al., 2021
head kidney myeloid cell decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
whole organism lyz expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 2 with image from Fang et al., 2021
whole organism asxl1 expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 1 with image from Fang et al., 2021
head kidney neutrophil lyz expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
head kidney neutrophil immature, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 3 with image from Fang et al., 2021
whole organism cbx4 expression decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 6 with image from Fang et al., 2021
whole organism decreased weight, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 1 with image from Fang et al., 2021
whole organism ab33-h3 labeling decreased amount, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 7 with image from Fang et al., 2021
caudal hematopoietic tissue mpx expression decreased distribution, abnormal asxl1sm19/sm19 (AB) standard conditions Fig. 2 with image from Fang et al., 2021
Citations