CRISPR

CRISPR1-asxl1

ID

ZDB-CRISPR-220825-1

Name

CRISPR1-asxl1

Previous Names

None

Target

asxl1 (1)

Sequence

5' - GGGTGTGGATGTCATCAGGACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sm18	asxl1
sm19	asxl1

Expression

Gene expression in Wild Types + CRISPR1-asxl1

No data available

Phenotype

Phenotype resulting from CRISPR1-asxl1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-asxl1

Phenotype	Fish	Conditions	Figures
hepatocyte vacuole increased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 4 from Fang et al., 2021
head kidney neutrophil mpx expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
whole organism Ab4-h2a labeling decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 7 from Fang et al., 2021
head kidney neutrophil cebp1 expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
head kidney neutrophil decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
whole organism bmi1a expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 6 from Fang et al., 2021
liver fibrotic, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 4 from Fang et al., 2021
head kidney asxl1 expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 1 from Fang et al., 2021
head kidney erythroblast increased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
blood monocyte increased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 4 from Fang et al., 2021
head kidney neutrophil cebpa expression increased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
whole organism mpx expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 2 from Fang et al., 2021
neutrophil immature, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 2 from Fang et al., 2021
neutrophil decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 2 from Fang et al., 2021
liver macrophage infiltrative, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 4 from Fang et al., 2021
caudal hematopoietic tissue lyz expression decreased distribution, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 2 from Fang et al., 2021
head kidney monocyte increased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 4 from Fang et al., 2021
head kidney myeloid cell decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
whole organism lyz expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 2 from Fang et al., 2021
whole organism asxl1 expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 1 from Fang et al., 2021
head kidney neutrophil lyz expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
head kidney neutrophil immature, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 3 from Fang et al., 2021
whole organism cbx4 expression decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 6 from Fang et al., 2021
whole organism decreased weight, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 1 from Fang et al., 2021
whole organism ab33-h3 labeling decreased amount, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 7 from Fang et al., 2021
caudal hematopoietic tissue mpx expression decreased distribution, abnormal	asxl1^sm19/sm19 (AB)	standard conditions	Fig. 2 from Fang et al., 2021

Citations