CRISPR

CRISPR1-rab25a

ID

ZDB-CRISPR-220309-2

Name

CRISPR1-rab25a

Previous Names

None

Target

rab25a (1)

Sequence

5' - GTGGTTTTAATTGGAGAATCAGGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uot10	rab25a
uot9	rab25a

Expression

Gene expression in Wild Types + CRISPR1-rab25a

No data available

Phenotype

Phenotype resulting from CRISPR1-rab25a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-rab25a

Phenotype	Fish	Conditions	Figures
forerunner cell group disorganized, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
epiboly delayed, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 , Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL apical part of cell increased size, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 from Willoughby et al., 2021
whole organism rab25b expression increased amount, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
whole organism rab25a expression decreased amount, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
DEL epiboly delayed, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cell decreased size, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 from Willoughby et al., 2021
EVL cell morphology, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 , Figure 2—figure supplement 2. from Willoughby et al., 2021
EVL cell increased size, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 from Willoughby et al., 2021
EVL apical part of cell decreased size, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 from Willoughby et al., 2021
EVL epiboly delayed, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL endocytic recycling decreased process quality, abnormal	rab25a^uot9/uot9	control	Figure 7 from Willoughby et al., 2021
EVL cell mosaicism, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 from Willoughby et al., 2021
blastomere morphology, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cortical actin cytoskeleton decreased amount, abnormal	rab25a^uot9/uot9	standard conditions	Figure 6 from Willoughby et al., 2021
yolk cytoskeleton disorganized, abnormal	rab25a^uot9/uot9	standard conditions	Figure 2 from Willoughby et al., 2021
epiboly delayed, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 , Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL apical part of cell increased size, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 from Willoughby et al., 2021
whole organism rab25b expression increased amount, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
whole organism rab25a expression decreased amount, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
DEL epiboly delayed, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
forerunner cell group disorganized, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cell decreased size, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 from Willoughby et al., 2021
EVL cell morphology, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 , Figure 2—figure supplement 2. from Willoughby et al., 2021
EVL cell increased size, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 from Willoughby et al., 2021
EVL epiboly delayed, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL apical part of cell decreased size, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 from Willoughby et al., 2021
EVL endocytic recycling decreased process quality, abnormal	rab25a^uot10/uot10	control	Figure 7 from Willoughby et al., 2021
yolk cytoskeleton disorganized, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 from Willoughby et al., 2021
EVL cell mosaicism, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2 from Willoughby et al., 2021
blastomere morphology, abnormal	rab25a^uot10/uot10	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cortical actin cytoskeleton decreased amount, abnormal	rab25a^uot10/uot10	standard conditions	Figure 6 from Willoughby et al., 2021

Citations