CRISPR

CRISPR1-stag2b

ID
ZDB-CRISPR-210819-3
Name
CRISPR1-stag2b
Previous Names
None
Target
Sequence
5' - GGCCCTGGAGAGAAGGGAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nz207 stag2b
Expression
Gene expression in Wild Types + CRISPR1-stag2b
No data available
Phenotype
Phenotype resulting from CRISPR1-stag2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-stag2b
Phenotype Fish Conditions Figures
anterior lateral mesoderm tal1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
posterior lateral mesoderm anterior region tal1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
whole organism tal1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
posterior lateral mesoderm runx1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
swim bladder swim bladder inflation delayed, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 2 with image from Ketharnathan et al., 2020
anterior lateral mesoderm spi1b expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
anterior lateral mesoderm runx1 expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
caudal fin melanocyte displaced, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 2 with image from Ketharnathan et al., 2020
posterior lateral mesoderm gata1a expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
erythroid lineage cell gata1a expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
whole organism gata1a expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 3 with imageFigure 4 with image from Ketharnathan et al., 2020
anterior neural rod pax2a expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
erythroid lineage cell decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
whole organism stag2b expression decreased amount, abnormal stag2bnz207/nz207 (WIK) standard conditions Figure 2 with image from Ketharnathan et al., 2020
erythroid lineage cell gata1a expression decreased amount, abnormal stag2bnz207/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
erythroid lineage cell decreased amount, abnormal stag2bnz207/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
midbrain mCherry expression increased amount, abnormal stag2bnz207/nz207; ia5Tg/+ chemical treatment by environment: lithium chloride Figure 7. with image from Chin et al., 2020
midbrain Wnt signaling pathway increased occurrence, abnormal stag2bnz207/nz207; ia5Tg/+ standard conditions Figure 7. with image from Chin et al., 2020
midbrain mCherry expression increased amount, abnormal stag2bnz207/nz207; ia5Tg/+ standard conditions Figure 7. with image from Chin et al., 2020
Citations