CRISPR

CRISPR2-cox7a2l

ID
ZDB-CRISPR-210326-2
Name
CRISPR2-cox7a2l
Previous Names
None
Target
Sequence
5' - GGAGTACATGGGTAAAAACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
brn1 cox7a2l
brn2 cox7a2l
Expression
Gene expression in Wild Types + CRISPR2-cox7a2l
No data available
Phenotype
Phenotype resulting from CRISPR2-cox7a2l
No data available
Phenotype of all Fish created by or utilizing CRISPR2-cox7a2l
Phenotype Fish Conditions Figures
male organism fat cell increased size, abnormal cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
male organism decreased weight, abnormal cox7a2lbrn1/brn1 standard conditions 6 with image from García-Poyatos et al., 2020
ovarian follicle stage IV decreased amount, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
male organism adipose tissue increased volume, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
male organism fat cell increased size, abnormal cox7a2lbrn1/brn1 increased food availability Fig. 5 from García-Poyatos et al., 2020
male organism adipose tissue increased volume, exacerbated cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
female organism decreased length, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
male organism decreased length, abnormal cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
cardiac muscle cell mitochondrial intermembrane space increased width, abnormal cox7a2lbrn1/brn1 standard conditions 4 with image from García-Poyatos et al., 2020
female organism decreased weight, abnormal cox7a2lbrn1/brn1 increased food availability Fig. 5 from García-Poyatos et al., 2020
ovarian follicle stage IV decreased amount, abnormal cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
male organism adipose tissue increased volume, ameliorated cox7a2lbrn1/brn1 increased food availability Fig. 5 from García-Poyatos et al., 2020
female organism decreased length, abnormal cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
oocyte decreased amount, abnormal cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
male organism fat cell increased size, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
male organism decreased length, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with image from García-Poyatos et al., 2020
oocyte decreased amount, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism decreased weight, abnormal cox7a2lbrn1/brn1 standard conditions 3 with imageFig. 5 from García-Poyatos et al., 2020
whole organism oxygen transport increased rate, ameliorated cox7a2lbrn1/brn1 chemical treatment by environment: carbonyl cyanide p-trifluoromethoxyphenylhydrazone 4 with image from García-Poyatos et al., 2020
cardiac muscle cell mitochondrion decreased size, abnormal cox7a2lbrn1/brn1 standard conditions 4 with image from García-Poyatos et al., 2020
female organism fat cell increased size, abnormal cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
female organism fat cell increased size, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism fat cell increased size, abnormal cox7a2lbrn1/brn1 increased food availability Fig. 5 from García-Poyatos et al., 2020
female organism adipose tissue increased volume, abnormal cox7a2lbrn1/brn1 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism adipose tissue increased volume, ameliorated cox7a2lbrn1/brn1 increased food availability Fig. 5 from García-Poyatos et al., 2020
female organism adipose tissue increased volume, exacerbated cox7a2lbrn1/brn1 high fat 6 with image from García-Poyatos et al., 2020
male organism fat cell increased size, abnormal cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
male organism decreased weight, abnormal cox7a2lbrn2/brn2 standard conditions 6 with image from García-Poyatos et al., 2020
male organism adipose tissue increased volume, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
ovarian follicle stage IV decreased amount, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism decreased length, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
male organism adipose tissue increased volume, exacerbated cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
male organism fat cell increased size, abnormal cox7a2lbrn2/brn2 increased food availability Fig. 5 from García-Poyatos et al., 2020
male organism decreased length, abnormal cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
cardiac muscle cell mitochondrial intermembrane space increased width, abnormal cox7a2lbrn2/brn2 standard conditions 4 with image from García-Poyatos et al., 2020
ovarian follicle stage IV decreased amount, abnormal cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
male organism adipose tissue increased volume, ameliorated cox7a2lbrn2/brn2 increased food availability Fig. 5 from García-Poyatos et al., 2020
female organism decreased length, abnormal cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
oocyte decreased amount, abnormal cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
male organism decreased length, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with image from García-Poyatos et al., 2020
male organism fat cell increased size, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
oocyte decreased amount, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism decreased weight, abnormal cox7a2lbrn2/brn2 standard conditions 3 with imageFig. 5 from García-Poyatos et al., 2020
whole organism oxygen transport increased rate, ameliorated cox7a2lbrn2/brn2 chemical treatment by environment: carbonyl cyanide p-trifluoromethoxyphenylhydrazone 4 with image from García-Poyatos et al., 2020
cardiac muscle cell mitochondrion decreased size, abnormal cox7a2lbrn2/brn2 standard conditions 4 with image from García-Poyatos et al., 2020
female organism fat cell increased size, abnormal cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
female organism fat cell increased size, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism adipose tissue increased volume, abnormal cox7a2lbrn2/brn2 standard conditions 3 with image6 with imageFig. 5 from García-Poyatos et al., 2020
female organism fat cell increased size, abnormal cox7a2lbrn2/brn2 increased food availability Fig. 5 from García-Poyatos et al., 2020
female organism adipose tissue increased volume, ameliorated cox7a2lbrn2/brn2 increased food availability Fig. 5 from García-Poyatos et al., 2020
female organism adipose tissue increased volume, exacerbated cox7a2lbrn2/brn2 high fat 6 with image from García-Poyatos et al., 2020
Citations