CRISPR

CRISPR1-appb

ID
ZDB-CRISPR-210115-1
Name
CRISPR1-appb
Previous Names
None
Target
Sequence
5' - GGATGACTCGGTGGGCTTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3355 appb
zf3356 appb
Expression
Gene expression in Wild Types + CRISPR1-appb
No data available
Phenotype
Phenotype resulting from CRISPR1-appb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-appb
Phenotype Fish Conditions Figures
whole organism appa expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Figure 2. with imageFigure 7. with image from Rahmati et al., 2024
whole organism appb expression decreased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Figure 2. with imageFigure 7. with image from Rahmati et al., 2024
Fig. 8 with image from Banote et al., 2020
whole organism decreased size, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 1 with image from Banote et al., 2020
eye appa expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
whole organism Ab8-app labeling increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
whole organism cell adhesion decreased process quality, abnormal appbzf3355/zf3355 (AB) control Fig. 6 with image from Banote et al., 2020
blastomere cell projection structure, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 1 with image from Banote et al., 2020
hindbrain appb expression decreased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
whole organism dead, abnormal appbzf3355/zf3355 (AB) chemical treatment: ionomycin Fig. 6 with image from Banote et al., 2020
spinal cord appb expression decreased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
midbrain appb expression decreased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
periderm cell shape, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 3 with image from Banote et al., 2020
whole organism aplp2 expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Figure 2. with imageFigure 7. with image from Rahmati et al., 2024
whole organism cell adhesion decreased process quality, abnormal appbzf3355/zf3355 (AB) chemical treatment: ionomycin Fig. 6 with image from Banote et al., 2020
periderm cell increased area, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 3 with image from Banote et al., 2020
somite appa expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
brain appb expression decreased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Figure 2. with image from Rahmati et al., 2024
Fig. 1 with image from Banote et al., 2020
head appa expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
whole organism decreased length, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 1 with image from Banote et al., 2020
head aplp2 expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
whole organism epiboly delayed, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 2 from Banote et al., 2020
forebrain appb expression decreased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
trunk aplp2 expression increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 8 with image from Banote et al., 2020
periderm cell-cell junction increased amount, abnormal appbzf3355/zf3355 (AB) standard conditions Fig. 3 with image from Banote et al., 2020
whole organism aplp2 expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf1 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appa expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf1 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appb expression decreased amount, abnormal appbzf3355/zf3355 + MO1-upf1 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism aplp2 expression increased amount, abnormal appbzf3355/zf3355 + MO2-upf2 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism aplp1 expression increased amount, abnormal appbzf3355/zf3355 + MO2-upf2 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appa expression increased amount, abnormal appbzf3355/zf3355 + MO2-upf2 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appb expression decreased amount, abnormal appbzf3355/zf3355 + MO2-upf2 (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism aplp2 expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appa expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appb expression decreased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism aplp1 expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism ab2-app labeling decreased amount, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 6 with image from Chebli et al., 2021
whole organism appa expression decreased amount, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 6 with image from Chebli et al., 2021
third ventricle decreased volume, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 9 with image from Chebli et al., 2021
third ventricle decreased area, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 9 with image from Chebli et al., 2021
whole organism Ab8-app labeling decreased amount, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 6 with image from Chebli et al., 2021
whole organism appb expression decreased amount, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 6 with image from Chebli et al., 2021
third ventricle cilium increased length, abnormal appazf3579/zf3579; appbzf3355/zf3355 (AB) standard conditions Figure 7 with image from Chebli et al., 2021
Citations