CRISPR

CRISPR3-spast

ID
ZDB-CRISPR-201110-5
Name
CRISPR3-spast
Previous Names
None
Target
Sequence
5' - TGTAGGTGATAAGCAGAAGGCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ula1 spast
Expression
Gene expression in Wild Types + CRISPR3-spast
No data available
Phenotype
Phenotype resulting from CRISPR3-spast
No data available
Phenotype of all Fish created by or utilizing CRISPR3-spast
Phenotype Fish Conditions Figures
skeletal muscle atl1 expression increased amount, abnormal spastula1/ula1 standard conditions Fig 7 with image from Arribat et al., 2020
skeletal muscle bscl2 expression increased amount, abnormal spastula1/ula1 standard conditions Fig 7 with image from Arribat et al., 2020
skeletal muscle N-docosanoylsphingosine decreased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
fast muscle cell endoplasmic reticulum aggregated, abnormal spastula1/ula1 standard conditions Fig 3 with image from Arribat et al., 2020
skeletal muscle spartb expression increased amount, abnormal spastula1/ula1 standard conditions Fig 7 with image from Arribat et al., 2020
skeletal muscle reep1 expression increased amount, abnormal spastula1/ula1 standard conditions Fig 7 with image from Arribat et al., 2020
whole organism decreased length, abnormal spastula1/ula1 standard conditions Fig 2 with image from Arribat et al., 2020
brain atl1 expression increased amount, abnormal spastula1/ula1 standard conditions Fig 7 with image from Arribat et al., 2020
yolk anatomical region increased accumulation fat cell, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
whole organism lipid droplet decreased size, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
skeletal muscle cholesteryl ester decreased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
aerobic respiration decreased magnitude, abnormal spastula1/ula1 standard conditions Fig 2 with image from Arribat et al., 2020
head lipid increased amount, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
blood vessel lipid increased amount, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
swim bladder anatomical region increased accumulation fat cell, abnormal spastula1/ula1 standard conditions Fig 3 with image from Arribat et al., 2020
skeletal muscle hexadecatrienoic acid decreased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
swimming decreased occurrence, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
slow muscle cell endoplasmic reticulum flattened, abnormal spastula1/ula1 standard conditions Fig 3 with image from Arribat et al., 2020
hatching delayed, abnormal spastula1/ula1 standard conditions Fig 2 with image from Arribat et al., 2020
brain phosphatidylethanolamine 34:0 zwitterion increased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
whole organism lipid droplet condensed, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
swimming decreased occurrence, abnormal spastula1/ula1 chemical treatment by environment: tunicamycin Fig 3 with image from Arribat et al., 2020
brain phosphatidylethanolamine 40:3 zwitterion increased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
brain N-octadecanoylsphingosine decreased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
swimming decreased linear velocity, abnormal spastula1/ula1 chemical treatment by environment: tunicamycin Fig 3 with image from Arribat et al., 2020
whole organism lipid droplet increased distribution, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
whole organism lipid droplet increased amount, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
skeletal muscle hexadecanoic acid decreased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
swimming decreased linear velocity, abnormal spastula1/ula1 chemical treatment by environment: oleic acid Fig 3 with image from Arribat et al., 2020
brain reep1 expression increased amount, abnormal spastula1/ula1 standard conditions Fig 7 with image from Arribat et al., 2020
brain phosphatidylethanolamine 36:1 zwitterion increased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
whole organism decreased weight, abnormal spastula1/ula1 standard conditions Fig 2 with image from Arribat et al., 2020
brain phosphatidylethanolamine 36:2 zwitterion increased amount, abnormal spastula1/ula1 standard conditions Fig 8 with image from Arribat et al., 2020
Citations