CRISPR

CRISPR1-igf2bp3

ID
ZDB-CRISPR-200812-1
Name
CRISPR1-igf2bp3
Previous Names
None
Target
Sequence
5' - TGTGGATTGCCCCGACGAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hza57 igf2bp3
hza58 igf2bp3
Expression
Gene expression in Wild Types + CRISPR1-igf2bp3
No data available
Phenotype
Phenotype resulting from CRISPR1-igf2bp3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-igf2bp3
Phenotype Fish Conditions Figures
blastomere aurkb expression decreased amount, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 5 with image from Ren et al., 2020
blastomere cleavage furrow ab2-tuba labeling decreased amount, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 2 with image from Ren et al., 2020
yolk opacity, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
fertilized egg cortical granule exocytosis disrupted, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 2 with image from Ren et al., 2020
cleavage furrow ingression disrupted, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
blastomere regulation of RNA stability disrupted, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 3 with image from Ren et al., 2020
blastomere circular, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
blastomere regulation of RNA stability disrupted, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 5 with image from Ren et al., 2020
blastomere cellular adhesivity, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 1 with image,  Fig. 2 with image from Ren et al., 2020
cytokinesis disrupted, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 2 with image from Ren et al., 2020
blastodisc cleavage furrow structure, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 2 with image from Ren et al., 2020
embryonic cleavage disrupted, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
blastomere cleavage furrow Ab4-ctnnb1 labeling decreased amount, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 2 with image from Ren et al., 2020
blastomere actin filament decreased amount, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 2 with image from Ren et al., 2020
blastodisc cleavage furrow increased amount, abnormal igf2bp3hza57/hza57 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
cleavage furrow ingression disrupted, abnormal igf2bp3hza58/hza58 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
yolk opacity, abnormal igf2bp3hza58/hza58 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
blastomere cellular adhesivity, abnormal igf2bp3hza58/hza58 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
blastomere circular, abnormal igf2bp3hza58/hza58 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
embryonic cleavage disrupted, abnormal igf2bp3hza58/hza58 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
blastodisc cleavage furrow increased amount, abnormal igf2bp3hza58/hza58 (AB) standard conditions Fig. 1 with image from Ren et al., 2020
Citations