CRISPR

CRISPR2-rpl18

ID
ZDB-CRISPR-200729-1
Name
CRISPR2-rpl18
Previous Names
None
Target
Sequence
5' - GGGAGAGAGCCAGAGGTGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3219 rpl18
Expression
Gene expression in Wild Types + CRISPR2-rpl18
No data available
Phenotype
Phenotype resulting from CRISPR2-rpl18
No data available
Phenotype of all Fish created by or utilizing CRISPR2-rpl18
Phenotype Fish Conditions Figures
erythrocyte maturation disrupted, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 3 with image from Chen et al., 2020
erythroid lineage cell gata1a expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 3 with image from Chen et al., 2020
whole organism mdm2 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
head edematous, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism dead, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism fas expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
whole organism il6st expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
whole organism tlr9 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S9 from Chen et al., 2020
whole organism ab1-stat3 labeling increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 6 with image from Chen et al., 2020
head aplastic, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism stat3 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
whole organism ccng1 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
whole organism tp53 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
whole organism socs3b expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
whole organism irf7 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
pigmentation delayed, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism il10 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
head decreased size, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism cdkn1a expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
whole organism bbc3 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
pericardium increased size, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
erythroid lineage cell hbae1.1 expression decreased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 3 with image from Chen et al., 2020
whole organism il6 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
nucleate erythrocyte increased amount, ameliorated rpl18zf3219/zf3219 (TU) chemical treatment by environment: EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor Fig. 6 with image from Chen et al., 2020
whole organism socs3a expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
whole organism ab1-stat3 labeling amount, ameliorated rpl18zf3219/zf3219 (TU) chemical treatment by environment: STAT3 inhibitor Fig. 6 with image from Chen et al., 2020
erythroid lineage cell Ab2-gata1a labeling decreased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 3 with image from Chen et al., 2020
whole organism casp8 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
whole organism decreased life span, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism apoptotic process increased occurrence, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
erythroid lineage cell hbbe1.1 expression decreased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 3 with image from Chen et al., 2020
whole organism ab1-stat3 labeling amount, ameliorated rpl18zf3219/zf3219 (TU) chemical treatment by environment: EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor Fig. 6 with image from Chen et al., 2020
whole organism mmp9 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S9 from Chen et al., 2020
whole organism irf9 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
whole organism baxa expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
whole organism myca expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
whole organism isg15 expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S9 from Chen et al., 2020
whole organism mcl1b expression increased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. S7 from Chen et al., 2020
nucleate erythrocyte decreased amount, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
pericardium edematous, abnormal rpl18zf3219/zf3219 (TU) standard conditions Fig. 2 with image from Chen et al., 2020
whole organism hemoglobin increased amount, ameliorated rpl18zf3219/zf3219 (TU) chemical treatment by environment: STAT3 inhibitor Fig. S10 from Chen et al., 2020
nucleate erythrocyte increased amount, ameliorated rpl18zf3219/zf3219 (TU) chemical treatment by environment: STAT3 inhibitor Fig. 6 with image from Chen et al., 2020
blood hemoglobin decreased amount, abnormal rpl18zf3219/+ (TU) standard conditions Fig. S11 from Chen et al., 2020
nucleate erythrocyte decreased amount, abnormal rpl18zf3219/+ (TU) standard conditions Fig. S11 from Chen et al., 2020
erythrocyte maturation disrupted, abnormal rpl18zf3219/+ (TU) standard conditions Fig. S11 from Chen et al., 2020
whole organism hemoglobin increased amount, ameliorated rpl18zf3219/zf3219 + MO4-tp53 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.