CRISPR
CRISPR1-pcyt2
- ID
- ZDB-CRISPR-200604-5
- Name
- CRISPR1-pcyt2
- Previous Names
- None
- Target
- Sequence
-
5' - GATACGGGCCATCAAGTGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "TGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-pcyt2
No data available
Phenotype
Phenotype resulting from CRISPR1-pcyt2
1 - 5 of 5
Phenotype of all Fish created by or utilizing CRISPR1-pcyt2
1 - 5 of 5
Citations
- Cikes, D., Elsayad, K., Sezgin, E., Koitai, E., Ferenc, T., Orthofer, M., Yarwood, R., Heinz, L.X., Sedlyarov, V., Miranda, N.D., Taylor, A., Grapentine, S., Al-Murshedi, F., Abot, A., Weidinger, A., Kutchukian, C., Sanchez, C., Cronin, S.J.F., Novatchkova, M., Kavirayani, A., Schuetz, T., Haubner, B., Haas, L., Hagelkruys, A., Jackowski, S., Kozlov, A., Jacquemond, V., Knauf, C., Superti-Furga, G., Rullman, E., Gustafsson, T., McDermot, J., Lowe, M., Radak, Z., Chamberlain, J.S., Bakovic, M., Banka, S., Penninger, J.M. (2023) PCYT2-regulated lipid biosynthesis is critical to muscle health and ageing. Nature metabolism. 5(3):495-515
- Vaz, F.M., McDermott, J.H., Alders, M., Wortmann, S.B., Kölker, S., Pras-Raves, M.L., Vervaart, M.A.T., van Lenthe, H., Luyf, A.C.M., Elfrink, H.L., Metcalfe, K., Cuvertino, S., Clayton, P.E., Yarwood, R., Lowe, M.P., Lovell, S., Rogers, R.C., Deciphering Developmental Disorders Study, van Kampen, A.H.C., Ruiter, J.P.N., Wanders, R.J.A., Ferdinandusse, S., van Weeghel, M., Engelen, M., Banka, S. (2019) Mutations in PCYT2 disrupt etherlipid biosynthesis and cause a complex hereditary spastic paraplegia. Brain : a journal of neurology. 142(11):3382-3397
1 - 2 of 2
Show