CRISPR

CRISPR3-tlx1

ID
ZDB-CRISPR-200429-4
Name
CRISPR3-tlx1
Previous Names
None
Target
Sequence
5' - GGGTCCTACAACATGAACTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cq201 tlx1
cq202 tlx1
Expression
Gene expression in Wild Types + CRISPR3-tlx1
No data available
Phenotype
Phenotype resulting from CRISPR3-tlx1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-tlx1
Phenotype Fish Conditions Figures
whole organism nfkb2 expression increased amount, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
liver tnfb expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
gut left side tlx1 expression absent, abnormal tlx1cq201/cq201 standard conditions Fig. 3 from Xie et al., 2019
whole organism decreased life span, exacerbated tlx1cq201/cq201 bacterial treatment by injection: Aeromonas hydrophila Fig. 5 from Xie et al., 2019
whole organism nfkb2 expression increased amount, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
intestine nfkb2 expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
intestine tnfa expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
kidney ighm expression decreased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 9 with image from Xie et al., 2021
spleen absent, abnormal tlx1cq201/cq201 standard conditions Fig. 4 from Xie et al., 2019
whole organism il1b expression increased amount, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
trunk apoptotic process increased occurrence, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
whole organism tnfa expression increased amount, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
intestine tnfb expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
whole organism il6 expression increased amount, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
whole organism tnfb expression increased amount, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
trunk apoptotic process increased occurrence, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
liver tnfa expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
liver il6 expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
kidney mhc2dhb expression decreased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 9 with image from Xie et al., 2021
liver il10 expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
liver il1b expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
immune response decreased process quality, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 9 with image from Xie et al., 2021
whole organism il10 expression increased amount, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
whole organism tnfb expression increased amount, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
whole organism il10 expression increased amount, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
intestine il10 expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
whole organism il6 expression increased amount, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
intestine il1b expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
liver nfkb2 expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
intestine il6 expression increased amount, abnormal tlx1cq201/cq201 vaccine treatment: Aeromonas hydrophila Figure 4 with image from Xie et al., 2021
whole organism tnfa expression increased amount, abnormal tlx1cq201/cq201 chemical treatment by environment: lipopolysaccharide Figure 1 with image from Xie et al., 2021
whole organism il1b expression increased amount, abnormal tlx1cq201/cq201 bacterial treatment by exposure to environment: Aeromonas hydrophila Figure 1 with image from Xie et al., 2021
kidney cpox expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney hbba1 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney cxcl18b expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 5 from Xie et al., 2023
kidney fech expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3,  Fig. 5 from Xie et al., 2023
kidney uros expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney tfr1a expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney gata1a expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney klf1 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney alas2 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney urod expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney steap3 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney abcb10 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney slc25a37 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney hbaa1 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney ppox expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney tfa expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney hbba2 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1 from Xie et al., 2023
kidney hbaa2 expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1 from Xie et al., 2023
kidney gata2a expression decreased amount, abnormal tlx1cq201/cq201 (AB) standard conditions Fig. 1 from Xie et al., 2023
gut left side tlx1 expression absent, abnormal tlx1cq202/cq202 standard conditions Fig. 3 from Xie et al., 2019
whole organism decreased life span, exacerbated tlx1cq202/cq202 bacterial treatment by injection: Aeromonas hydrophila Fig. 5 from Xie et al., 2019
spleen absent, abnormal tlx1cq202/cq202 standard conditions Fig. 4 from Xie et al., 2019
kidney cpox expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney hbba1 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney cxcl18b expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 5 from Xie et al., 2023
kidney uros expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney fech expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3,  Fig. 5 from Xie et al., 2023
kidney tfr1a expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney gata1a expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney klf1 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney urod expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney alas2 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney steap3 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney abcb10 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney slc25a37 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney ppox expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney hbaa1 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1,  Fig. 5 from Xie et al., 2023
kidney hbaa2 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1 from Xie et al., 2023
kidney gata2a expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1 from Xie et al., 2023
kidney tfa expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 3 from Xie et al., 2023
kidney hbba2 expression decreased amount, abnormal tlx1cq202/cq202 (AB) standard conditions Fig. 1 from Xie et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.