CRISPR
CRISPR2-etsrp
- ID
- ZDB-CRISPR-200423-3
- Name
- CRISPR2-etsrp
- Previous Names
- None
- Target
- Sequence
-
5' - GGGAAAGGCCCAAGTCACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "AGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
Genomic Features
Expression
Gene expression in Wild Types + CRISPR2-etsrp
No data available
Phenotype
Phenotype resulting from CRISPR2-etsrp
No data available
Phenotype of all Fish created by or utilizing CRISPR2-etsrp
1 - 5 of 59 Show all
Citations
- Gurung, S., Restrepo, N.K., Anand, S.K., Sittaramane, V., Sumanas, S. (2024) Requirement of a novel gene, drish, in the zebrafish retinal ganglion cell and primary motor axon development. Developmental Dynamics : an official publication of the American Association of Anatomists. 253(8):750-770
- Gurung, S., Restrepo, N.K., Chestnut, B., Klimkaite, L., Sumanas, S. (2022) Single-cell transcriptomic analysis of vascular endothelial cells in zebrafish embryos. Scientific Reports. 12:13065
- Metikala, S., Warkala, M., Casie Chetty, S., Chestnut, B., Rufin Florat, D., Plender, E., Nester, O., Koenig, A.L., Astrof, S., Sumanas, S. (2022) Integration of vascular progenitors into functional blood vessels represents a distinct mechanism of vascular growth. Developmental Cell. 57(6):767-782.e6
- Chestnut, B., Casie Chetty, S., Koenig, A.L., Sumanas, S. (2020) Single-cell transcriptomic analysis identifies the conversion of zebrafish Etv2-deficient vascular progenitors into skeletal muscle. Nature communications. 11:2796
- Chestnut, B., Sumanas, S. (2019) Zebrafish etv2 knock-in line labels vascular endothelial and blood progenitor cells. Developmental Dynamics : an official publication of the American Association of Anatomists. 249(2):245-261
1 - 5 of 5
Show