CRISPR

CRISPR2-etsrp

ID
ZDB-CRISPR-200423-3
Name
CRISPR2-etsrp
Previous Names
None
Target
Sequence
5' - GGGAAAGGCCCAAGTCACAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
Genomic Features
Genomic Feature Affected Genomic Regions
ci32Gt etsrp
ci33 etsrp
Expression
Gene expression in Wild Types + CRISPR2-etsrp
No data available
Phenotype
Phenotype resulting from CRISPR2-etsrp
No data available
Phenotype of all Fish created by or utilizing CRISPR2-etsrp
Phenotype Fish Conditions Figures
anterior lateral plate mesoderm etsrp expression decreased amount, abnormal etsrpci32Gt/+; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
dorsal aorta etsrp expression decreased amount, abnormal etsrpci32Gt/+; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
common cardinal vein etsrp expression decreased amount, abnormal etsrpci32Gt/+; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
intermediate cell mass of mesoderm etsrp expression decreased amount, abnormal etsrpci32Gt/+; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
cranial vasculature etsrp expression decreased amount, abnormal etsrpci32Gt/+; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
intersegmental vessel EGFP expression absent, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
intersegmental vessel decreased amount, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
cranial vasculature EGFP expression decreased distribution, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
intermediate cell mass of mesoderm etsrp expression decreased distribution, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
blood vessel development disrupted, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with imageFig. 9 with image from Chestnut et al., 2019
intersegmental vessel absent, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
intermediate cell mass of mesoderm etsrp expression decreased amount, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
common cardinal vein EGFP expression absent, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
common cardinal vein etsrp expression absent, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
cranial vasculature etsrp expression decreased amount, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
anterior lateral plate mesoderm etsrp expression absent, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
intersegmental vessel EGFP expression decreased distribution, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
dorsal aorta etsrp expression absent, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
cranial vasculature etsrp expression decreased distribution, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 7 with image from Chestnut et al., 2019
cranial vasculature EGFP expression decreased amount, abnormal etsrpci32Gt/ci32Gt; nkuasgfp1aTg standard conditions Fig. 8 with image from Chestnut et al., 2019
Citations