CRISPR

CRISPR1-cds2

ID

ZDB-CRISPR-200416-3

Name

CRISPR1-cds2

Previous Names

None

Target

cds2 (1)

Sequence

5' - GAGAACCTCCGGTGTGTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cas008	cds2

Expression

Gene expression in Wild Types + CRISPR1-cds2

No data available

Phenotype

Phenotype resulting from CRISPR1-cds2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cds2

Phenotype	Fish	Conditions	Figures
intersegmental vessel malformed, abnormal	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: phosphatidylglycerol	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, abnormal	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: phosphatidylglycerol	Fig. 3 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate	Fig. 3 from Zhao et al., 2019
intersegmental vessel malformed, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. 1 , Fig. 3 , Fig. 4 , Fig. 6 from Zhao et al., 2019
whole organism egln3 expression increased amount, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. S1 from Zhao et al., 2019
intersegmental vessel decreased size, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. 1 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by environment: AS1842856	Fig. 6 from Zhao et al., 2019
whole organism epoa expression increased amount, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. S1 from Zhao et al., 2019
whole organism igfbp1a expression increased amount, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. S1 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate	Fig. 3 from Zhao et al., 2019
whole organism vegfaa expression increased amount, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. 1 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: phosphatidylinositol	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, abnormal	cds2^{cas008/cas008}; y1Tg	control	Fig. 1 , Fig. 3 , Fig. 4 , Fig. 6 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by injection: phosphatidylinositol	Fig. 3 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg	chemical treatment by environment: AS1842856	Fig. 6 from Zhao et al., 2019
intersegmental vessel retracted, abnormal	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylglycerol, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate	Fig. 3 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, abnormal	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylglycerol, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel malformed, exacerbated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylglycerol, heat shock	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, exacerbated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylglycerol, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock, chemical treatment by environment: AS1842856	Fig. 6 from Zhao et al., 2019
intersegmental vessel retracted, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate	Fig. 3 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylinositol, heat shock	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, exacerbated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock	Fig. 1 , Fig. 3 , Fig. 4 , Fig. 6 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylinositol, heat shock	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylinositol, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel retracted, abnormal	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock	Fig. 1 , Fig. 3 , Fig. 4 , Fig. 6 , Fig. 7 from Zhao et al., 2019
intersegmental vessel retracted, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: phosphatidylinositol, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, abnormal	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock	Fig. 1 , Fig. 3 , Fig. 4 , Fig. 6 , Fig. 7 from Zhao et al., 2019
intersegmental vessel malformed, abnormal	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock	Fig. 7 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate, heat shock	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock, chemical treatment by environment: AS1842856	Fig. 6 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate	Fig. 3 from Zhao et al., 2019
intersegmental vessel retracted, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel malformed, exacerbated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock	Fig. 1 , Fig. 3 , Fig. 4 , Fig. 6 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate, heat shock	Fig. 3 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock, chemical treatment by environment: AS1842856	Fig. 6 from Zhao et al., 2019
intersegmental vessel retracted, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	heat shock, chemical treatment by environment: AS1842856	Fig. 6 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg	chemical treatment by injection: 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate	Fig. 3 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg + MO3-ptena + MO3-ptenb	control	Fig. 4 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg + MO3-ptena + MO3-ptenb	control	Fig. 4 from Zhao et al., 2019
intersegmental vessel retracted, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO4-plcg1	heat shock	Fig. 7 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO4-plcg1	heat shock	Fig. 7 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO4-plcg1	heat shock	Fig. 7 from Zhao et al., 2019
intersegmental vessel retracted, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO3-ptena + MO3-ptenb	heat shock	Fig. 4 from Zhao et al., 2019
intersegmental vessel malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO3-ptena + MO3-ptenb	heat shock	Fig. 4 from Zhao et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis process quality, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO3-ptena + MO3-ptenb	heat shock	Fig. 4 from Zhao et al., 2019
trunk vasculature malformed, ameliorated	cds2^{cas008/cas008}; y1Tg; zf1092Tg + MO3-ptena + MO3-ptenb	heat shock	Fig. 4 from Zhao et al., 2019

Citations