CRISPR

CRISPR1-abcc6a

ID

ZDB-CRISPR-200416-1

Name

CRISPR1-abcc6a

Previous Names

None

Target

abcc6a (1)

Sequence

5' - AAGAAAGCGGCAGCCGACCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cmg52	abcc6a

Expression

Gene expression in Wild Types + CRISPR1-abcc6a

No data available

Phenotype

Phenotype resulting from CRISPR1-abcc6a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-abcc6a

Phenotype	Fish	Conditions	Figures
vertebra fused with vertebra, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
vertebral column malformed, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
vertebra biomineral tissue development increased occurrence, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
whole organism decreased length, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
rib bifurcated, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
swimming disrupted, abnormal	abcc6a^cmg52/cmg52	standard conditions	text only from Van Gils et al., 2018
whole organism abcc6a expression decreased amount, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. S2 from Van Gils et al., 2018
vertebral column fragile, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
rib fused with rib, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
rib increased width, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
vertebral column bone mineralization increased occurrence, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
feeding behavior disrupted, abnormal	abcc6a^cmg52/cmg52	standard conditions	text only from Van Gils et al., 2018
vertebral column curved, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
rib irregularly shaped, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
rib fragile, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
vertebra structure, abnormal	abcc6a^cmg52/cmg52	standard conditions	Fig. 1 from Van Gils et al., 2018
notochord outer sheath cell biomineral tissue development occurrence, ameliorated	abcc6a^cmg52/cmg52 (AB)	chemical treatment by environment: sodium thiosulfate	FIGURE 1 , FIGURE 3 from Van Gils et al., 2022
notochord outer sheath cell biomineral tissue development occurrence, ameliorated	abcc6a^cmg52/cmg52 (AB)	chemical treatment by environment: etidronate disodium	FIGURE 1 from Van Gils et al., 2022
notochord outer sheath cell biomineral tissue development occurrence, ameliorated	abcc6a^cmg52/cmg52 (AB)	chemical treatment by environment: magnesium citrate	FIGURE 1 from Van Gils et al., 2022
whole organism biomineral tissue development increased occurrence, abnormal	abcc6a^cmg52/cmg52 (AB)	chemical treatment by environment: sodium thiosulfate	FIGURE 3 from Van Gils et al., 2022
notochord outer sheath cell biomineral tissue development increased occurrence, abnormal	abcc6a^cmg52/cmg52 (AB)	control	FIGURE 1 from Van Gils et al., 2022
notochord outer sheath cell biomineral tissue development occurrence, ameliorated	abcc6a^cmg52/cmg52 (AB)	chemical treatment by environment: alendronate sodium trihydrate	FIGURE 1 from Van Gils et al., 2022
notochord outer sheath cell biomineral tissue development occurrence, ameliorated	abcc6a^cmg52/cmg52 (AB)	chemical treatment by environment: phylloquinone	FIGURE 1 from Van Gils et al., 2022

Citations