CRISPR

CRISPR1-dre-mir-182

ID
ZDB-CRISPR-191202-3
Name
CRISPR1-dre-mir-182
Previous Names
  • CRISPR1-mir182
Target
Sequence
5' - GGGGACAAAAGGTTCTCTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two 'G's were added to facilitate T7-dependent transcription.
Genome Resources
None
Target Location
View all 6 target locations
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-dre-mir-182
No data available
Phenotype
Phenotype resulting from CRISPR1-dre-mir-182
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dre-mir-182
Phenotype Fish Conditions Figures
neuromast has fewer parts of type neuromast hair cell, abnormal Df(Chr4:dre-mir-183,dre-mir-182)lri81/lri81 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-183 expression decreased amount, abnormal Df(Chr4:dre-mir-183,dre-mir-182)lri81/lri81 standard conditions Fig. 3 with image from Fogerty et al., 2019
retina dre-mir-182 expression decreased amount, abnormal Df(Chr4:dre-mir-183,dre-mir-182)lri81/lri81 standard conditions Fig. 3 with image from Fogerty et al., 2019
retina dre-mir-96 expression decreased amount, abnormal dre-mir-96lri79a/lri79a standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell, abnormal dre-mir-96lri79a/lri79a chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-182 expression decreased amount, abnormal dre-mir-96lri79a/lri79a standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell, abnormal dre-mir-182lri61/lri61 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-182 expression decreased amount, abnormal dre-mir-182lri61/lri61 standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast hair cell stereocilium maintenance decreased process quality, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-96 expression absent, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 3 with image from Fogerty et al., 2019
whole organism semi-viable, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 6 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retinal cone cell photoreceptor inner segment decreased length, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 4 with image from Fogerty et al., 2019
retina dre-mir-183 expression absent, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 3 with image from Fogerty et al., 2019
retina dre-mir-182 expression decreased amount, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast hair cell detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 8 with image from Fogerty et al., 2019
neuromast hair cell stereocilium bundle malformed, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 7 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell stereocilium bundle, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 8 with image from Fogerty et al., 2019
Citations