CRISPR

CRISPR1-asip1

ID

ZDB-CRISPR-190725-1

Name

CRISPR1-asip1

Previous Names

None

Target

asip1 (1)

Sequence

5' - GCACACACACATGCCAATGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 6

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
iim016	asip1
iim02	asip1
iim08	asip1

Expression

Gene expression in Wild Types + CRISPR1-asip1

No data available

Phenotype

Phenotype resulting from CRISPR1-asip1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-asip1

Phenotype	Fish	Conditions	Figures
head ventral surface has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 7 from Cal et al., 2019
trunk ventral surface has extra parts of type xanthophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 4 , Fig. 7 from Cal et al., 2019
melanocyte increased amount, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
xanthophore increased amount, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
trunk ventral surface has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 7 from Cal et al., 2019
scale ventral region has extra parts of type iridophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
ventral mandibular arch has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
melanophore stripe has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 4 , Fig. 7 from Cal et al., 2019
scale ventral region has extra parts of type xanthophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
trunk ventral surface has fewer parts of type iridophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 7 from Cal et al., 2019
melanophore stripe dorsalized, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
scale ventral region has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
scale ventral region dorsalized, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
iridophore irregular spatial pattern, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk ventral surface has fewer parts of type iridophore, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk ventral surface has extra parts of type xanthophore, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk ventral surface has extra parts of type melanocyte, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk dorsal surface has fewer parts of type melanocyte, abnormal	asip1^iim08; iim05Tg	standard conditions	Fig. 7 from Cal et al., 2019

Citations

Include unpublished citations

Cal, L., Suarez-Bregua, P., Comesaña, P., Owen, J., Braasch, I., Kelsh, R., Cerdá-Reverter, J.M., Rotllant, J. (2019) Countershading in zebrafish results from an Asip1 controlled dorsoventral gradient of pigment cell differentiation. Scientific Reports. 9:3449

1 - 1 of 1

Show