CRISPR

CRISPR3-stat3

ID
ZDB-CRISPR-190318-1
Name
CRISPR3-stat3
Previous Names
None
Target
Sequence
5' - GGTCGATCTTAAGTCCTTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia23 stat3
Expression
Gene expression in Wild Types + CRISPR3-stat3
No data available
Phenotype
Phenotype resulting from CRISPR3-stat3
No data available
Phenotype of all Fish created by or utilizing CRISPR3-stat3
No data available
Citations